ERG (NM_001243428) Human Untagged Clone

CAT#: SC330121

ERG (untagged) - Homo sapiens v-ets avian erythroblastosis virus E26 oncogene homolog (ERG), transcript variant 5

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ERG
• Synonyms: erg-3; p55
• Vector: pCMV6-XL4
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: None
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243428, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGATTCAGACTGTCCCGGACCCAGCAGCTCATATCAAGGAAGCCTTATCAGTTGTGAGTGAGGACCAGT
  CGTTGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGTCCTCCTCCAGCGA
  CTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGCAGGATTGGCTGTCTCAACCCCCAGCCAGG
  GTCACCATCAAAATGGAATGTAACCCTAGCCAGGTGAATGGCTCAAGGAACTCTCCTGATGAATGCAGTG
  TGGCCAAAGGCGGGAAGATGGTGGGCAGCCCAGACACCGTTGGGATGAACTACGGCAGCTACATGGAGGA
  GAAGCACATGCCACCCCCAAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAGATCCTACGCTA
  TGGAGTACAGACCATGTGCGGCAGTGGCTGGAGTGGGCGGTGAAAGAATATGGCCTTCCAGACGTCAACA
  TCTTGTTATTCCAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGGCTCAC
  CCCCAGCTACAACGCCGACATCCTTCTCTCACATCTCCACTACCTCAGAGAGACTCCTCTTCCACATTTG
  ACTTCAGATGATGTTGATAAAGCCTTACAAAACTCTCCACGGTTAATGCATGCTAGAAACACAGGGGGTG
  CAGCTTTTATTTTCCCAAATACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGATTT
  ACCATATGAGCCCCCCAGGAGATCAGCCTGGACCGGTCACGGCCACCCCACGCCCCAGTCGAAAGCTGCT
  CAACCATCTCCTTCCACAGTGCCCAAAACTGAAGACCAGCGTCCTCAGTTAGATCCTTATCAGATTCTTG
  GACCAACAAGTAGCCGCCTTGCAAATCCAGGCAGTGGCCAGATCCAGCTTTGGCAGTTCCTCCTGGAGCT
  CCTGTCGGACAGCTCCAACTCCAGCTGCATCACCTGGGAAGGCACCAACGGGGAGTTCAAGATGACGGAT
  CCCGACGAGGTGGCCCGGCGCTGGGGAGAGCGGAAGAGCAAACCCAACATGAACTACGATAAGCTCAGCC
  GCGCCCTCCGTTACTACTATGACAAGAACATCATGACCAAGGTCCATGGGAAGCGCTACGCCTACAAGTT
  CGACTTCCACGGGATCGCCCAGGCCCTCCAGCCCCACCCCCCGGAGTCATCTCTGTACAAGTACCCCTCA
  GACCTCCCGTACATGGGCTCCTATCACGCCCACCCACAGAAGATGAACTTTGTGGCGCCCCACCCTCCAG
  CCCTCCCCGTGACATCTTCCAGTTTTTTTGCTGCCCCAAACCCATACTGGAATTCACCAACTGGGGGTAT
  ATACCCCAACACTAGGCTCCCCACCAGCCATATGCCTTCTCATCTGGGCACTTACTACTAA
  
  
• Restriction Sites: KpnI-XbaI
• ACCN: NM_001243428
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243428.1, NP_001230357.1
• RefSeq Size: 5139 bp
• RefSeq ORF: 1461 bp
• Locus ID: 2078
• Cytogenetics: 21q22.2
• Protein Families: Druggable Genome, Transcription Factors
• Gene Summary: 'This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014]'
  Transcript Variant: This variant (5) differs in the 5' UTR, compared to variant 3. Variants 3 and 5 encode the same protein (isoform 3). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.