FXYD6 (NM_001243598) Human Untagged Clone

CAT#: SC330149

FXYD6 (untagged) - Homo sapiens FXYD6-FXYD2 readthrough (FXYD6-FXYD2), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: FXYD6
• Synonyms: FXYD6
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243598, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGTTGGTGCTGGTCTTCCTCTGCAGCCTGCTGGCCCCCATGGTCCTGGCCAGTGCAGCTGAAAAGG
  AGAAGGAAATGGACCCTTTTCATTATGATTACCAGACCCTGAGGATTGGGGGACTGGTGTTCGCTGTGGT
  CCTCTTCTCGGTTGGGATCCTCCTTATCCTAAGGCCCCAGGAGATGAGGAAGCCCAGGTGGAGAACCTCA
  TCACCGCCAATGCAACAGAGCCCCAGAAAGCAGAGAACTGAAGTGCAGCCATCAGGTGGAAGGCGGCAGC
  CCCAAGGGGGACGTGGACCCGTTCTACTATGGCAGAAGATTCCGCTGTGGGGGCAATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243598
• ORF Size: 339 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243598.2, NP_001230527.1
• RefSeq Size: 1122
• RefSeq ORF: 339
• Locus ID: 100533181
• Gene Summary: This locus represents naturally occurring read-through transcription between the neighboring FXYD domain-containing ion transport regulator 6 (GeneID 53826) and sodium/potassium-transporting ATPase subunit gamma (GeneID 486) genes on chromosome 11. One read-through transcript produces a fusion protein that shares sequence identity with each individual gene product, while another read-through transcript encodes a protein that has a distinct C-terminus and only shares sequence identity with the upstream locus (GeneID 53826). [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (2) has multiple differences in the coding region, compared to variant 1, one of which results in a translational frameshift. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.