RAB6A (NM_001243718) Human Untagged Clone
CAT#: SC330163
RAB6A (untagged) - Homo sapiens RAB6A, member RAS oncogene family (RAB6A), transcript variant 4
"NM_001243718" in other vectors (2)
Product Images
Other products for "RAB6A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RAB6A |
Synonyms | RAB6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243718, the custom clone sequence may differ by one or more nucleotides
ATGTCCACGGGCGGAGACTTCGGGAATCCGCTGAGGAAATTCAAGCTGGTGTTCCTGGGGGAGCAAAGCG TTGGAAAGACATCTTTGATCACCAGATTCATGTATGACAGTTTTGACAACACCTATCAGGCAACAATTGG CATTGACTTTTTATCAAAAACTATGTACTTGGAGGATCGAACACTCTTTCGACGTGTAGCAGCAGCTTTG CCGGGAATGGAAAGCACACAGGACAGAAGCAGAGAAGATATGATTGACATAAAACTGGAAAAGCCTCAGG AGCAACCAGTCAGTGAAGGAGGCTGTTCCTGCTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243718 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001243718.1, NP_001230647.1 |
RefSeq Size | 3096 bp |
RefSeq ORF | 315 bp |
Locus ID | 5870 |
Cytogenetics | 11q13.4 |
Protein Families | Druggable Genome |
Gene Summary | 'This gene encodes a member of the RAB family, which belongs to the small GTPase superfamily. GTPases of the RAB family bind to various effectors to regulate the targeting and fusion of transport carriers to acceptor compartments. This protein is located at the Golgi apparatus, which regulates trafficking in both a retrograde (from early endosomes and Golgi to the endoplasmic reticulum) and an anterograde (from the Golgi to the plasma membrane) directions. Myosin II is an effector of this protein in these processes. This protein is also involved in assembly of human cytomegalovirus (HCMV) by interacting with the cellular protein Bicaudal D1, which interacts with the HCMV virion tegument protein, pp150. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]' Transcript Variant: This variant (4) lacks two consecutive exons in the coding region, and the reading frame is not affected, compared to variant 1. The resulting isoform (d) lacks an internal segment, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.