USP2 (NM_001243759) Human Untagged Clone

CAT#: SC330173

USP2 (untagged) - Homo sapiens ubiquitin specific peptidase 2 (USP2), transcript variant 3


  "NM_001243759" in other vectors (2)

Reconstitution Protocol

USD 370.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "USP2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol USP2
Synonyms UBP41; USP9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_001243759, the custom clone sequence may differ by one or more nucleotides


ATGCTTGTGCCCGGTTCGACTCGTCCATACTCCAAGAAGAGGCAGAATTCTAAGAGTGCCCAGGGTCTGG
CTGGTCTTCGAAACCTTGGGAACACGTGCTTCATGAACTCAATTCTGCAGTGCCTGAGCAACACTCGGGA
GTTGAGAGATTACTGCCTCCAGAGGCTCTACATGCGGGACCTGCACCACGGCAGCAATGCACACACAGCC
CTCGTGGAAGAGTTTGCAAAACTAATTCAGACCATATGGACTTCATCCCCCAATGATGTGGTGAGCCCAT
CTGAGTTCAAGACCCAGATCCAGAGATACGCACCGCGCTTTGTTGGCTATAATCAGCAGGATGCTCAGGA
GTTCCTTCGCTTTCTTCTGGATGGGCTCCATAACGAGGTGAACCGAGTGACACTGAGACCTAAGTCCAAC
CCTGAGAACCTCGATCATCTTCCTGATGACGAGAAAGGCCGACAGATGTGGAGAAAATATCTAGAACGGG
AAGACAGTAGGATCGGGGATCTCTTTGTTGGGCAGCTAAAGAGCTCGCTGACGTGTACAGATTGTGGTTA
CTGTTCTACGGTCTTCGACCCCTTCTGGGACCTCTCACTGCCCATTGCTAAGCGAGGTTATCCTGAGGTG
ACATTAATGGACTGCATGAGGCTCTTCACCAAAGAGGATGTGCTTGATGGAGATGAAAAGCCAACATGCT
GTCGCTGCCGAGGCAGAAAACGGTGTATAAAGAAGTTCTCCATCCAGAGGTTCCCAAAGATCTTGGTGCT
CCATCTGAAGCGGTTCTCAGAATCCAGGATCCGAACCAGCAAGCTCACAACATTTGTGAACTTCCCCCTA
AGAGACCTGGACTTAAGAGAATTTGCCTCAGAAAACACCAACCATGCTGTTTACAACCTGTACGCTGTGT
CCAATCACTCCGGAACCACCATGGGTGGCCACTATACAGCCTACTGTCGCAGTCCAGGGACAGGAGAATG
GCACACTTTCAACGACTCCAGCGTCACTCCCATGTCCTCCAGCCAAGTGCGCACCAGCGACGCCTACCTG
CTCTTCTACGAACTGGCCAGCCCGCCCTCCCGAATGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001243759
ORF Size 1089 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243759.1, NP_001230688.1
RefSeq Size 2933
RefSeq ORF 1089
Locus ID 9099
Protein Families Protease
Gene Summary This gene encodes a member of the family of de-ubiquitinating enzymes, which belongs to the peptidase C19 superfamily. The encoded protein is a ubiquitin-specific protease which is required for TNF-alpha (tumor necrosis factor alpha) -induced NF-kB (nuclear factor kB) signaling. This protein deubiquitinates polyubiquitinated target proteins such as fatty acid synthase, murine double minute 2 (MDM2), MDM4/MDMX and cyclin D1. MDM2 and MDM4 are negative regulators of the p53 tumor suppressor and cyclin D1 is required for cell cycle G1/S transition. Multiple alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (3) lacks an internal exon in the 5' region, compared to variant 1. The resulting isoform (c) has a shorter and different N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.