GNG2 (NM_001243773) Human Untagged Clone

CAT#: SC330179

GNG2 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 2 (GNG2), transcript variant 2


  "NM_001243773" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GNG2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GNG2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243773, the custom clone sequence may differ by one or more nucleotides


ATGGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAGATGGAAGCCA
ATATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTACTGTGAAGCACATGCCAAGGA
AGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCGTTTAGGGAGAAGAAGTTTTTCTGTGCCATC
CTTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001243773
ORF Size 216 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243773.1, NP_001230702.1
RefSeq Size 3899
RefSeq ORF 216
Locus ID 54331
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Gene Summary This gene encodes one of the gamma subunits of a guanine nucleotide-binding protein. Such proteins are involved in signaling mechanisms across membranes. Various subunits forms heterodimers which then interact with the different signal molecules. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (2) uses a different splice site in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.