GNG2 (NM_001243773) Human Untagged Clone
CAT#: SC330179
GNG2 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 2 (GNG2), transcript variant 2
"NM_001243773" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GNG2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243773, the custom clone sequence may differ by one or more nucleotides
ATGGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAGATGGAAGCCA ATATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTACTGTGAAGCACATGCCAAGGA AGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCGTTTAGGGAGAAGAAGTTTTTCTGTGCCATC CTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243773 |
ORF Size | 216 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243773.1, NP_001230702.1 |
RefSeq Size | 3899 |
RefSeq ORF | 216 |
Locus ID | 54331 |
Protein Families | Druggable Genome |
Protein Pathways | Chemokine signaling pathway |
Gene Summary | This gene encodes one of the gamma subunits of a guanine nucleotide-binding protein. Such proteins are involved in signaling mechanisms across membranes. Various subunits forms heterodimers which then interact with the different signal molecules. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (2) uses a different splice site in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231538 | GNG2 (Myc-DDK tagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 2 (GNG2), transcript variant 2 |
USD 420.00 |
|
RG231538 | GNG2 (GFP-tagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 2 (GNG2), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review