GNG2 (NM_001243774) Human Untagged Clone

CAT#: SC330180

GNG2 (untagged) - Homo sapiens guanine nucleotide binding protein (G protein), gamma 2 (GNG2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GNG2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243774, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCCAGCAACAACACCGCCAGCATAGCACAAGCCAGGAAGCTGGTAGAGCAGCTTAAGATGGAAGCCA
  ATATCGACAGGATAAAGGTGTCCAAGGCAGCTGCAGATTTGATGGCCTACTGTGAAGCACATGCCAAGGA
  AGACCCCCTCCTGACCCCTGTTCCGGCTTCAGAAAACCCGTTTAGGGAGAAGAAGTTTTTCTGTGCCATC
  CTTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243774
• ORF Size: 216 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001243774.1, NP_001230703.1
• RefSeq Size: 3862
• RefSeq ORF: 216
• Locus ID: 54331
• Protein Families: Druggable Genome
• Protein Pathways: Chemokine signaling pathway
• Gene Summary: This gene encodes one of the gamma subunits of a guanine nucleotide-binding protein. Such proteins are involved in signaling mechanisms across membranes. Various subunits forms heterodimers which then interact with the different signal molecules. [provided by RefSeq, Aug 2011]
  Transcript Variant: This variant (3) lacks an alternate exon in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.