SMUG1 (NM_001243791) Human Untagged Clone
CAT#: SC330190
SMUG1 (untagged) - Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1 (SMUG1), transcript variant 6
"NM_001243791" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SMUG1 |
Synonyms | FDG; HMUDG; UNG3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243791, the custom clone sequence may differ by one or more nucleotides
ATGCCCCAGGCTTTCCTGCTGGGGTCCATCCATGAGCCTGCAGGTGCCCTCATGGAGCCCCAGCCCTGCC CTGGAAGCTTGGCTGAGAGCTTCCTGGAGGAGGAGCTTCGGCTCAATGCTGAGCTGAGCCAGCTGCAGTT TTCGGAGCCTGTGGGCATCATCTACAATCCCGTGGAGTATGCATGGGAGCCACATCGCAACTACGTGACT CGCTACTGCCAGGGCCCCAAGGAAGTACTCTTCCTGGGCATGAACCCTGGACCTTTTGGCATGGCCCAGA CTGGGGTGCCCTTTGGGGAAGTAAGCATGGTCCGGGACTGGTTGGGCATTGTGGGGCCTGTGCTGACCCC TCCCCAAGAGCATCCTAAACGACCAGTGCTGGGACTGGAGTGCCCACAGTCAGAAGGACCAAGACAAAGC ATGGGACATGAAATTAAGAGTGAACTTCTTATGGGAGGCTGCAGCTGGATCAGAGGAAAAATCCAGTGTG ACAGAGTGCAAGTCAGAAGACCTGGCTTTTCATCCCAGCTTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243791 |
ORF Size | 534 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243791.1, NP_001230720.1 |
RefSeq Size | 685 |
RefSeq ORF | 534 |
Locus ID | 23583 |
Protein Families | Druggable Genome |
Protein Pathways | Base excision repair |
Gene Summary | This gene encodes a protein that participates in base excision repair by removing uracil from single- and double-stranded DNA. Many alternatively spliced transcript variants exist for this gene; the full-length nature is known for some but not all of the variants. [provided by RefSeq, Aug 2011] Transcript Variant: This variant (6) differs in the 5' UTR, 3' UTR, and coding region, compared to variant 1. The resulting protein (isoform 2) has a shorter and different C-terminus when it is compared to isoform 1. Variants 4, 5, and 6 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231979 | SMUG1 (Myc-DDK tagged) - Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1 (SMUG1), transcript variant 6 |
USD 420.00 |
|
RG231979 | SMUG1 (GFP-tagged) - Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1 (SMUG1), transcript variant 6 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review