SMUG1 (NM_001243791) Human Untagged Clone

CAT#: SC330190

SMUG1 (untagged) - Homo sapiens single-strand-selective monofunctional uracil-DNA glycosylase 1 (SMUG1), transcript variant 6


  "NM_001243791" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SMUG1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SMUG1
Synonyms FDG; HMUDG; UNG3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001243791, the custom clone sequence may differ by one or more nucleotides


ATGCCCCAGGCTTTCCTGCTGGGGTCCATCCATGAGCCTGCAGGTGCCCTCATGGAGCCCCAGCCCTGCC
CTGGAAGCTTGGCTGAGAGCTTCCTGGAGGAGGAGCTTCGGCTCAATGCTGAGCTGAGCCAGCTGCAGTT
TTCGGAGCCTGTGGGCATCATCTACAATCCCGTGGAGTATGCATGGGAGCCACATCGCAACTACGTGACT
CGCTACTGCCAGGGCCCCAAGGAAGTACTCTTCCTGGGCATGAACCCTGGACCTTTTGGCATGGCCCAGA
CTGGGGTGCCCTTTGGGGAAGTAAGCATGGTCCGGGACTGGTTGGGCATTGTGGGGCCTGTGCTGACCCC
TCCCCAAGAGCATCCTAAACGACCAGTGCTGGGACTGGAGTGCCCACAGTCAGAAGGACCAAGACAAAGC
ATGGGACATGAAATTAAGAGTGAACTTCTTATGGGAGGCTGCAGCTGGATCAGAGGAAAAATCCAGTGTG
ACAGAGTGCAAGTCAGAAGACCTGGCTTTTCATCCCAGCTTTGA


Restriction Sites SgfI-MluI     
ACCN NM_001243791
ORF Size 534 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001243791.1, NP_001230720.1
RefSeq Size 685
RefSeq ORF 534
Locus ID 23583
Protein Families Druggable Genome
Protein Pathways Base excision repair
Gene Summary This gene encodes a protein that participates in base excision repair by removing uracil from single- and double-stranded DNA. Many alternatively spliced transcript variants exist for this gene; the full-length nature is known for some but not all of the variants. [provided by RefSeq, Aug 2011]
Transcript Variant: This variant (6) differs in the 5' UTR, 3' UTR, and coding region, compared to variant 1. The resulting protein (isoform 2) has a shorter and different C-terminus when it is compared to isoform 1. Variants 4, 5, and 6 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.