PPP1R14A (NM_001243947) Human Untagged Clone
CAT#: SC330197
PPP1R14A (untagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), transcript variant 2
"NM_001243947" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PPP1R14A |
Synonyms | CPI-17; CPI17; PPP1INL |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001243947, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCTCAGCGGCTGGGCAAGCGCGTGCTGAGCAAGCTGCAGTCTCCATCGCGGGCCCGCGGGCCAG GGGGCAGTCCCGGGGGGCTGCAGAAGCGGCACGCGCGCGTCACCGTCAAGTATGACCGGCGGGAGCTGCA GCGGCGGCTGGACGTGGAGAAGTGGATCGACGGGCGCCTGGAGGAGCTGTACCGCGGCATGGGACTCCTG AAGTCATGTGGGAAACCTGTCGAGGACTTCATCCAGGAGCTGCTGGCAAAGCTTCAAGGCCTCCACAGGC AGCCCGGCCTCCGCCAGCCAAGCCCCTCCCACGACGGCAGCCTCAGCCCCCTCCAGGACCGGGCCCGGAC TGCTCACCCCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001243947 |
ORF Size | 363 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001243947.1, NP_001230876.1 |
RefSeq Size | 701 |
RefSeq ORF | 363 |
Locus ID | 94274 |
Protein Families | Druggable Genome |
Protein Pathways | Vascular smooth muscle contraction |
Gene Summary | The protein encoded by this gene belongs to the protein phosphatase 1 (PP1) inhibitor family. This protein is an inhibitor of smooth muscle myosin phosphatase, and has higher inhibitory activity when phosphorylated. Inhibition of myosin phosphatase leads to increased myosin phosphorylation and enhanced smooth muscle contraction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Sep 2011] Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1. This results in a shorter isoform (2, also known as CPI-17beta) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231707 | PPP1R14A (Myc-DDK tagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), transcript variant 2 |
USD 420.00 |
|
RG231707 | PPP1R14A (GFP-tagged) - Homo sapiens protein phosphatase 1, regulatory (inhibitor) subunit 14A (PPP1R14A), transcript variant 2 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review