HLA-DRB1 (NM_001243965) Human Untagged Clone

CAT#: SC330203

HLA (untagged) - Homo sapiens major histocompatibility complex, class II, DR beta 1 (HLA-DRB1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: HLA-DRB1
• Synonyms: DRB1; HLA-DR1B; HLA-DRB; SS1
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001243965, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGTGTCTGAGGCTCCCTGGAGGCTCCTGCATGGCAGTTCTGACAGTGACACTGATGGTGCTGAGCT
  CCCCACTGGCTTTGGCTGGGGACACCAGACCACGTTTCTTGGAGTACTCTACGTCTGAGTGTCATTTCTT
  CAATGGGACGGAGCGGGTGCGGTACCTGGACAGATACTTCCATAACCAGGAGGAGAACGTGCGCTTCGAC
  AGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCTGATGCCGAGTACTGGAACAGCCAGA
  AGGACCTCCTGGAGCAGAAGCGGGGCCGGGTGGACAACTACTGCAGACACAACTACGGGGTTGTGGAGAG
  CTTCACAGTGCAGCGGCGAGTCCATCCTAAGGTGACTGTGTATCCTTCAAAGACCCAGCCCCTGCAGCAC
  CATAACCTCCTGGTCTGTTCTGTGAGTGGTTTCTATCCAGGCAGCATTGAAGTCAGGTGGTTCCGGAATG
  GCCAGGAAGAGAAGACTGGGGTGGTGTCCACAGGCCTGATCCACAATGGAGACTGGACCTTCCAGACCCT
  GGTGATGCTGGAAACAGTTCCTCGGAGTGGAGAGGTTTACACCTGCCAAGTGGAGCACCCAAGCGTGACA
  AGCCCTCTCACAGTGGAATGGAGAGCACGGTCTGAATCTGCACAGAGCAAGATGCTGAGTGGAGTCGGGG
  GCTTTGTGCTGGGCCTGCTCTTCCTTGGGGCCGGGCTGTTCATCTACTTCAGGAATCAGAAAGGACACTC
  TGGACTTCAGCCAAGAGGATTCCTGAGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001243965
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001243965.1, NP_001230894.1
• RefSeq Size: 1233 bp
• RefSeq ORF: 801 bp
• Locus ID: 3123
• Cytogenetics: 6p21.32
• Protein Families: Transmembrane
• Protein Pathways: Allograft rejection, Antigen processing and presentation, Asthma, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Graft-versus-host disease, Hematopoietic cell lineage, Systemic lupus erythematosus, Type I diabetes mellitus, Viral myocarditis
• Gene Summary: 'HLA-DRB1 belongs to the HLA class II beta chain paralogs. The class II molecule is a heterodimer consisting of an alpha (DRA) and a beta chain (DRB), both anchored in the membrane. It plays a central role in the immune system by presenting peptides derived from extracellular proteins. Class II molecules are expressed in antigen presenting cells. The beta chain is approximately 26-28 kDa. It is encoded by 6 exons. Exon one encodes the leader peptide; exons 2 and 3 encode the two extracellular domains; exon 4 encodes the transmembrane domain; and exon 5 encodes the cytoplasmic tail. Within the DR molecule the beta chain contains all the polymorphisms specifying the peptide binding specificities. Hundreds of DRB1 alleles have been described and some alleles have increased frequencies associated with certain diseases or conditions. For example, DRB1*1302 has been related to acute and chronic hepatitis B virus persistence. There are multiple pseudogenes of this gene. [provided by RefSeq, Jul 2020]'
  Transcript Variant: This variant (2) represents the DRB1*03:01:01 allele of the HLA-DRB1 gene, as represented in the alternate locus groups ALT_REF_LOCI_2 and ALT_REF_LOCI_6 of the reference genome.