APE1 (APEX1) (NM_001244249) Human Untagged Clone

CAT#: SC330209

APEX1 (untagged) - Homo sapiens APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1), transcript variant 4


  "NM_001244249" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "APEX1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol APEX1
Synonyms APE; APE1; APEN; APEX; APX; HAP1; REF1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001244249, the custom clone sequence may differ by one or more nucleotides


ATGCCGAAGCGTGGGAAAAAGGGAGCGGTGGCGGAAGACGGGGATGAGCTCAGGACAGAGCCAGAGGCCA
AGAAGAGTAAGACGGCCGCAAAGAAAAATGACAAAGAGGCAGCAGGAGAGGGCCCAGCCCTGTATGAGGA
CCCCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGAT
GGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCC
TTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCA
ATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTC
AAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACT
CGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCG
CTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGAC
CTCAATGTGGCACATGAAGAAATTGACCTTCGCAACCCCAAGGGGAACAAAAAGAATGCTGGCTTCACGC
CACAAGAGCGCCAAGGCTTCGGGGAATTACTGCAGGCTGTGCCACTGGCTGACAGCTTTAGGCACCTCTA
CCCCAACACACCCTATGCCTACACCTTTTGGACTTATATGATGAATGCTCGATCCAAGAATGTTGGTTGG
CGCCTTGATTACTTTTTGTTGTCCCACTCTCTGTTACCTGCATTGTGTGACAGCAAGATCCGTTCCAAGG
CCCTCGGCAGTGATCACTGTCCTATCACCCTATACCTAGCACTGTGA


Restriction Sites SgfI-MluI     
ACCN NM_001244249
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001244249.1, NP_001231178.1
RefSeq Size 1558 bp
RefSeq ORF 957 bp
Locus ID 328
Cytogenetics 14q11.2
Protein Families Druggable Genome, Stem cell - Pluripotency, Transcription Factors
Protein Pathways Base excision repair
Gene Summary 'The APEX gene encodes the major AP endonuclease in human cells. It encodes the APEX endonuclease, a DNA repair enzyme with apurinic/apyrimidinic (AP) activity. Such AP activity sites occur frequently in DNA molecules by spontaneous hydrolysis, by DNA damaging agents or by DNA glycosylases that remove specific abnormal bases. The AP sites are the most frequent pre-mutagenic lesions that can prevent normal DNA replication. Splice variants have been found for this gene; all encode the same protein. Disruptions in the biological functions related to APEX are associated with many various malignancies and neurodegenerative diseases.[provided by RefSeq, Dec 2019]'
Transcript Variant: This variant (4) uses a donor splice site for exon 1 downstream of that used by variant 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.