IMMP2L (NM_001244606) Human Untagged Clone

CAT#: SC330214

IMMP2L (untagged) - Homo sapiens IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae) (IMMP2L), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IMMP2L
• Synonyms: IMMP2L-IT1; IMP2; IMP2-LIKE
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244606, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCACAGTCACAAGGGTGGGTGAAAAGATACATCAAGGCCTTTTGTAAAGGCTTCTTTGTGGCGGTGC
  CTGTGGCAGTGACTTTCTTGGATCGGGTCGCCTGTGTGGCAAGAGTAGAAGGAGCATCGATGCAGCCTTC
  TTTGAATCCTGGGGGGAGCCAGTCATCTGATGTGGTGCTTTTGAACCACTGGAAAGTGAGGAATTTTGAA
  GTACACCGTGGTGACATTGTATCATTGGTGTCTCCTAAAAACCCAGAACAGAAGATCATTAAGAGAGTGA
  TTGCTCTTGAAGGAGATATTGTCAGAACCATAGGACACAAAAACCGGTATGTCAAAGTCCCCCGTGGTCA
  CATCTGGGTTGAAGGTGATCATCATGGACACAGTTTTGACAGTAATTCTTTTGGGCCGGTTTCCCTAGGA
  CTTCTGCATGCCCATGCCACACATATCCTGTGGCCCCCAGAGCGCTGGCAGAAATTGGAATCTGTTCTTC
  CTCCAGAGCGCTTACCAGTACAGAGAGAAGAGGAATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244606
• ORF Size: 528 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001244606.1, NP_001231535.1
• RefSeq Size: 1225
• RefSeq ORF: 528
• Locus ID: 83943
• Protein Families: Druggable Genome, Protease
• Gene Summary: This gene encodes a protein involved in processing the signal peptide sequences used to direct mitochondrial proteins to the mitochondria. The encoded protein resides in the mitochondria and is one of the necessary proteins for the catalytic activity of the mitochondrial inner membrane peptidase (IMP) complex. Two variants that encode the same protein have been described for this gene. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (2), as well as variants 1, 3, and 4, encodes isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.