CHMP2B (NM_001244644) Human Untagged Clone

CAT#: SC330215

CHMP2B (untagged) - Homo sapiens charged multivesicular body protein 2B (CHMP2B), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CHMP2B
• Synonyms: ALS17; CHMP2.5; DMT1; VPS2-2; VPS2B
• Vector: pCMV6-Entry
• E. coli Selection: Kanamycin (25 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244644, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAATTAGAAATTAAGAAAATGGCCAAGATTGGTAATAAGGAAGCTTGCAAAGTTTTAGCCAAACAAC
  TTGTGCATCTACGGAAACAGAAGACGAGAACTTTTGCTGTAAGTTCAAAAGTTACTTCTATGTCTACACA
  AACAAAAGTGATGAATTCCCAAATGAAGATGGCTGGAGCAATGTCTACTACAGCAAAAACAATGCAGGCA
  GTTAACAAGAAGATGGATCCACAAAAGACATTACAAACAATGCAGAATTTCCAGAAGGAAAACATGAAAA
  TGGAAATGACTGAAGAAATGATCAATGATACACTTGATGACATCTTTGACGGTTCTGATGACGAAGAAGA
  AAGCCAGGATATTGTGAATCAAGTTCTTGATGAAATTGGAATTGAAATTTCTGGAAAGATGGCCAAAGCT
  CCATCAGCTGCTCGAAGCTTACCATCTGCCTCTACTTCAAAGGCTACAATCTCAGATGAAGAGATTGAAC
  GGCAACTCAAGGCTTTAGGAGTAGATTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244644
• ORF Size: 519 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001244644.1, NP_001231573.1
• RefSeq Size: 2551
• RefSeq ORF: 519
• Locus ID: 25978
• Protein Pathways: Endocytosis
• Gene Summary: This gene encodes a component of the heteromeric ESCRT-III complex (Endosomal Sorting Complex Required for Transport III) that functions in the recycling or degradation of cell surface receptors. ESCRT-III functions in the concentration and invagination of ubiquitinated endosomal cargos into intralumenal vesicles. The protein encoded by this gene is found as a monomer in the cytosol or as an oligomer in ESCRT-III complexes on endosomal membranes. It is expressed in neurons of all major regions of the brain. Mutations in this gene result in one form of familial frontotemporal lobar degeneration. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) lacks an alternate exon in the 5' coding region, compared to variant 1. The resulting predicted protein (isoform 2) is shorter when it is compared to isoform 1.