Syntaxin 5A (STX5) (NM_001244666) Human Untagged Clone

CAT#: SC330217

STX5 (untagged) - Homo sapiens syntaxin 5 (STX5), transcript variant 2


  "NM_001244666" in other vectors (2)

Reconstitution Protocol

USD 330.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "STX5"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol STX5
Synonyms SED5; STX5A
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001244666, the custom clone sequence may differ by one or more nucleotides


ATGATCCCGCGGAAACGCTACGGGTCTAAGAACACGGATCAGGGTGTCTACCTGGGTCTCTCAAAGACAC
AGGTCCTGTCCCCTGCAACTGCTGGCAGTAGCAGCAGCGACATCGCCCCTCTGCCCCCCCCAGTGACCCT
CGTCCCTCCCCCTCCCGACACCATGTCCTGCCGGGATCGGACCCAGGAGTTTCTGTCTGCCTGCAAGTCG
CTGCAGACCCGTCAGAATGGAATCCAGACAAATAAGCCAGCTTTGCGTGCTGTCCGACAACGCAGTGAAT
TCACCCTCATGGCCAAGCGCATTGGGAAAGACCTTAGCAACACATTTGCCAAGCTGGAGAAGCTGACAAT
CTTGGCAAAGCGCAAGTCCCTCTTTGATGATAAAGCAGTGGAAATTGAAGAGCTAACATATATCATCAAA
CAGGACATCAATAGCCTCAACAAACAAATTGCTCAGCTCCAGGATTTCGTGAGAGCCAAGGGCAGCCAGA
GTGGCCGGCACCTGCAGACCCACTCCAACACCATTGTGGTCTCCTTGCAGTCGAAACTGGCTTCTATGTC
CAATGACTTCAAATCGGTTTTAGAAGTGAGGACAGAGAACCTGAAGCAGCAGAGGAGCCGGAGAGAGCAG
TTCTCCCGGGCACCTGTGTCAGCCCTGCCCCTTGCCCCTAACCACCTGGGCGGTGGTGCTGTGGTTCTGG
GGGCAGAGTCCCATGCCTCCAAGGATGTCGCCATCGACATGATGGACTCTCGGACCAGCCAGCAGCTGCA
GCTCATTGACGAGCAGGATTCCTACATCCAGAGTCGGGCAGACACCATGCAGAACATTGAGTCGACAATT
GTTGAGTTGGGCTCCATCTTTCAGCAGTTGGCACACATGGTTAAGGAACAGGAGGAAACCATTCAGAGTG
TCCTTTTGTTTCCTCTTCTCCCGGCCTTGTCCCCAGGATCGACGAGAACGTGCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001244666
ORF Size 966 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001244666.1, NP_001231595.1
RefSeq Size 1872
RefSeq ORF 966
Locus ID 6811
Protein Families Druggable Genome, Transmembrane
Protein Pathways SNARE interactions in vesicular transport
Gene Summary This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region, which results in a frameshift and early stop codon compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.