TMEM126A (NM_001244735) Human Untagged Clone

CAT#: SC330222

TMEM126A (untagged) - Homo sapiens transmembrane protein 126A (TMEM126A), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TMEM126A
• Synonyms: OPA7
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244735, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAGGGATACCTTTTCTTACAACAGACTTAACTTACAGATGTTTTGTAAGTTTTCCTTTGAATACAG
  GTGATTTGGATTGTGAAACCTGTACCATAACACGGAGTGGACTGACTGGTCTTGTTATTGGTGGTCTATA
  CCCTGTTTTCTTGGCTATACCTGTAAATGGTGGTCTAGCAGCCAGGTATCAATCAGCTCTGTTACCACAC
  AAAGGGAACATCTTAAGTTACTGGATTAGAACTTCTAAGCCTGTCTTTAGAAAGATGTTATTTCCTATTT
  TGCTCCAGACTATGTTTTCAGCATACCTTGGGTCTGAACAATATAAACTACTTATAAAGGCCCTTCAGTT
  ATCTGAACCTGGCAAAGAAATTCACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244735
• ORF Size: 378 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001244735.1, NP_001231664.1
• RefSeq Size: 725
• RefSeq ORF: 378
• Locus ID: 84233
• Protein Families: Transmembrane
• Gene Summary: The protein encoded by this gene is a mitochondrial membrane protein of unknown function. Defects in this gene are a cause of optic atrophy type 7 (OPA7). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1 by lacking the exon containing the translation start site. The resulting isoform (2) is shorter at the N-terminus compared to isoform 1.