CD16b (FCGR3B) (NM_001244753) Human Untagged Clone
CAT#: SC330223
FCGR3B (untagged) - Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B), transcript variant 1
"NM_001244753" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | FCGR3B |
Synonyms | CD16; CD16A; CD16b; FCG3; FCGR3; FCGR3A; FCR-10; FCRIII; FCRIIIb |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001244753, the custom clone sequence may differ by one or more nucleotides
ATGGGTGGAGGGACTGGGGAAAGGCTGTTTACTCCCTCCTGTCTAGTCGGCTTGGTCCCTTTAGGGCTCC GGATATCTTTGGTGACTTGTCCACTCCAGTGTGGCATCATGTGGCAGCTGCTCCTCCCAACTGCTCTGCT ACTTCTAGTTTCAGCTGGCATGCGGACTGAAGATCTCCCAAAGGCTGTGGTGTTCCTGGAGCCTCAATGG TACAGCGTGCTTGAGAAGGACAGTGTGACTCTGAAGTGCCAGGGAGCCTACTCCCCTGAGGACAATTCCA CACAGTGGTTTCACAATGAGAACCTCATCTCAAGCCAGGCCTCGAGCTACTTCATTGACGCTGCCACAGT CAACGACAGTGGAGAGTACAGGTGCCAGACAAACCTCTCCACCCTCAGTGACCCGGTGCAGCTAGAAGTC CATATCGGCTGGCTGTTGCTCCAGGCCCCTCGGTGGGTGTTCAAGGAGGAAGACCCTATTCACCTGAGGT GTCACAGCTGGAAGAACACTGCTCTGCATAAGGTCACATATTTACAGAATGGCAAAGACAGGAAGTATTT TCATCATAATTCTGACTTCCACATTCCAAAAGCCACACTCAAAGATAGCGGCTCCTACTTCTGCAGGGGG CTTGTTGGGAGTAAAAATGTGTCTTCAGAGACTGTGAACATCACCATCACTCAAGGTTTGGCAGTGTCAA CCATCTCATCATTCTCTCCACCTGGGTACCAAGTCTCTTTCTGCTTGGTGATGGTACTCCTTTTTGCAGT GGACACAGGACTATATTTCTCTGTGAAGACAAACATTTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001244753 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001244753.1, NP_001231682.1 |
RefSeq Size | 2394 bp |
RefSeq ORF | 810 bp |
Locus ID | 2215 |
Cytogenetics | 1q23.3 |
Protein Families | ES Cell Differentiation/IPS, Secreted Protein, Transmembrane |
Protein Pathways | Natural killer cell mediated cytotoxicity, Systemic lupus erythematosus |
Gene Summary | 'The protein encoded by this gene is a low affinity receptor for the Fc region of gamma immunoglobulins (IgG). The encoded protein acts as a monomer and can bind either monomeric or aggregated IgG. This gene may function to capture immune complexes in the peripheral circulation. Several transcript variants encoding different isoforms have been found for this gene. A highly-similar gene encoding a related protein is also found on chromosome 1. [provided by RefSeq, Aug 2012]' Transcript Variant: This variant (1) encodes the longest isoform (2). Variants 1 and 2 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC232339 | FCGR3B (Myc-DDK tagged) - Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B), transcript variant 1 |
USD 420.00 |
|
RG232339 | FCGR3B (GFP-tagged) - Homo sapiens Fc fragment of IgG, low affinity IIIb, receptor (CD16b) (FCGR3B), transcript variant 1 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review