MOB4A (MOB1B) (NM_001244767) Human Untagged Clone

CAT#: SC330225

MOB1B (untagged) - Homo sapiens MOB kinase activator 1B (MOB1B), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: MOB1B
• Synonyms: MATS2; MOB4A; MOBKL1A
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001244767, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGCTTCTTGTTTGGTAGTCGCTCTTCTAAAACTTTTAAACCAAAGAAGAACATTCCAGAGGGTTCTC
  ACCAGTATGAGCTCTTAAAACACGCAGAAGCCACACTTGGCAGTGGCAACCTTCGGATGGCTGTCATGCT
  TCCTGAAGGGGAAGATCTCAATGAATGGGTTGCAGTTAACACTGTGGATTTCTTCAATCAGATCAACATG
  CTTTATGGAACTATCACAGACTTCTGTACAGAAGAGAGTTGTCCAGTGATGTCAGCTGGCCCAAAATATG
  AGTATCATTGGGCAGATGGAACGAACATAAAGAAACCTATTAAGTGCTCTGCACCAAAGTATATTGATTA
  CTTGATGACTTGGGTTCAGGACCAGTTGGATGATGAGACGTTATTTCCATCAAAAATTGGTATAATTAAT
  TTTTGTAAGGGGGATCCATCATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001244767
• ORF Size: 444 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001244767.1, NP_001231696.1
• RefSeq Size: 2063
• RefSeq ORF: 444
• Locus ID: 92597
• Gene Summary: The protein encoded by this gene is similar to the yeast Mob1 protein. Yeast Mob1 binds Mps1p, a protein kinase essential for spindle pole body duplication and mitotic checkpoint regulation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
  Transcript Variant: This variant (3) differs in the 5' and 3' UTRs and coding sequence compared to variant 1. The resulting isoform (3) has shorter and distinct N- and C-termini compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.