MS4A6A (NM_001247999) Human Untagged Clone

CAT#: SC330240

MS4A6A (untagged) - Homo sapiens membrane-spanning 4-domains, subfamily A, member 6A (MS4A6A), transcript variant 4


  "NM_001247999" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "MS4A6A"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol MS4A6A
Synonyms 4SPAN3; 4SPAN3.2; CD20L3; CDA01; MS4A6; MST090; MSTP090
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001247999, the custom clone sequence may differ by one or more nucleotides


ATGGTTTTACTGAAGTTGCTAGAAGTTTACAGAAAAGGAAGTGCAGGAACATTTCACAAATCTACAATCT
TTGGCAACACCATCATGACATCACAACCTGTTCCCAATGAGACCATCATAGTGCTCCCATCAAATGTCAT
CAACTTCTCCCAAGCAGAGAAACCCGAACCCACCAACCAGGGGCAGGATAGCCTGAAGAAACATCTACAC
GCAGAAATCAAAGTTATTGGGACTATCCAGATCTTGTGTGGCATGATGGTATTGAGCTTGGGGATCATTT
TGGCATCTGCTTCCTTCTCTCCAAATTTTACCCAAGTGACTTCTACACTGTTGAACTCTGCTTACCCATT
CATAGGACCCTTTTTTTTTATCATCTCTGGCTCTCTATCAATCGCCACAGAGAAAAGGTTAACCAAGCTT
TTGGTGCATAGCAGCCTGGTTGGAAGCATTCTGAGTGCTCTGTCTGCCCTGGTGGGTTTCATTATCCTGT
CTGTCAAACAGGCCACCTTAAATCCTGCCTCACTGCAGTGTGAGTTGGACAAAAATAATATACCAACAAG
AAGTTATGTTTCTTACTTTTATCATGATTCACTTTATACCACGGACTGCTATACAGCCAAAGCCAGTCTG
GCTGGAACTCTCTCTCTGATGCTGATTTGCACTCTGCTGGAATTCTGCCTAGCTGTGCTCACTGCTGTGC
TGCGGTGGAAACAGGCTTACTCTGACTTCCCTGGGGTGAGTGTGCTGGCCGGCTTCACTTAA


Restriction Sites SgfI-MluI     
ACCN NM_001247999
ORF Size 762 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001247999.1, NP_001234928.1
RefSeq Size 1751
RefSeq ORF 762
Locus ID 64231
Protein Families Druggable Genome, Transmembrane
Gene Summary This gene encodes a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. The gene encoding this protein is localized to 11q12.1, among a cluster of family members. Alternative splicing of this gene results in several transcript variants that encode different protein isoforms. [provided by RefSeq, Oct 2011]

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.