CD83 (NM_001251901) Human Untagged Clone
CAT#: SC330244
CD83 (untagged) - Homo sapiens CD83 molecule (CD83), transcript variant 3
"NM_001251901" in other vectors (2)
Product Images
Other products for "CD83"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | CD83 |
| Synonyms | BL11; HB15 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001251901, the custom clone sequence may differ by one or more nucleotides
ATGGAGACACCCCAGGAAGACCACCTCAGGGGACAGCACTATCATCAGAAGGGGCAAAATGGTTCTTTCG ACGCCCCCAATGAAAGGCCCTATTCCCTGAAGATCCGAAACACTACCAGCTGCAACTCGGGGACATACAG GTGCACTCTGCAGGACCCGGATGGGCAGAGAAACCTAAGTGGCAAGGTGATCTTGAGAGTGACAGGATGC CCTGCACAGCGTAAAGAAGAGACTTTTAAGAAATACAGAGCGGAGATTGTCCTGCTGCTGGCTCTGGTTA TTTTCTACTTAACACTCATCATTTTCACTTGTAAGTTTGCACGGCTACAGAGTATCTTCCCAGATTTTTC TAAAGCTGGCATGGAACGAGCTTTTCTCCCAGTTACCTCCCCAAATAAGCATTTAGGGCTAGTGACTCCT CACAAGACAGAACTGGTATGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001251901 |
| ORF Size | 441 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001251901.1, NP_001238830.1 |
| RefSeq Size | 2307 |
| RefSeq ORF | 441 |
| Locus ID | 9308 |
| Protein Families | Transmembrane |
| Gene Summary | The protein encoded by this gene is a single-pass type I membrane protein and member of the immunoglobulin superfamily of receptors. The encoded protein may be involved in the regulation of antigen presentation. A soluble form of this protein can bind to dendritic cells and inhibit their maturation. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (c) has a shorter N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China