DSCR1L1 (RCAN2) (NM_001251973) Human Untagged Clone

CAT#: SC330251

RCAN2 (untagged) - Homo sapiens regulator of calcineurin 2 (RCAN2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RCAN2
• Synonyms: CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001251973, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAGGGGAGAATCATACTTCATCGGAATGAGGAGCCCAGGGCAGCAGGGACACGTCCCTGAAGATGGAG
  GACTTTTCTTACTGTGCTGCATAGACAGGGACTGGGCTGTCACTCGTTGTTTTGCAGAAGAAGCCTTTCA
  AGCAATCACTGACTTCAATGACCTCCCCAACTCGTTGTTTGCGTGCAATGTTCACCAGTCAGTGTTTGAA
  GGAGAAGAGAGCAAGGAAAAATTTGAGGGACTGTTTCGGACTTATGATGACTGTGTGACGTTCCAGCTAT
  TTAAGAGTTTCAGACGTGTCCGTATAAACTTCAGCAATCCTAAATCTGCAGCCCGAGCTAGGATAGAGCT
  TCATGAAACCCAATTCAGAGGGAAAAAATTAAAGCTCTACTTTGCACAGGTTCAGACTCCAGAGACAGAT
  GGAGACAAACTGCACTTGGCTCCACCCCAGCCTGCCAAACAGTTTCTCATCTCGCCCCCTTCCTCCCCAC
  CTGTTGGCTGGCAGCCCATCAACGATGCCACGCCAGTCCTCAACTATGACCTCCTCTATGCTGTGGCCAA
  ACTAGGACCAGGAGAGAAGTATGAGCTCCATGCAGGGACTGAGTCCACCCCAAGTGTCGTCGTGCACGTG
  TGCGACAGTGACATAGAGGAAGAAGAGGACCCAAAGACTTCCCCAAAGCCAAAAATCATCCAAACTCGGC
  GTCCTGGCCTGCCACCCTCCGTGTCCAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001251973
• ORF Size: 732 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001251973.1, NP_001238902.1
• RefSeq Size: 3363
• RefSeq ORF: 732
• Locus ID: 10231
• Gene Summary: This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
  Transcript Variant: This variant (3, also known as beta-2) differs in the 5' UTR and uses an alternate start codon, compared to variant 1. Variants 2 and 3 encode the same isoform (2, also known as beta), which is longer and has a distinct N-terminus, compared to isoform 1.