DSCR1L1 (RCAN2) (NM_001251974) Human Untagged Clone
CAT#: SC330252
RCAN2 (untagged) - Homo sapiens regulator of calcineurin 2 (RCAN2), transcript variant 2
"NM_001251974" in other vectors (2)
Product Images
Other products for "RCAN2"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RCAN2 |
Synonyms | CSP2; DSCR1L1; MCIP2; RCN2; ZAKI-4; ZAKI4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001251974, the custom clone sequence may differ by one or more nucleotides
ATGAGGGGAGAATCATACTTCATCGGAATGAGGAGCCCAGGGCAGCAGGGACACGTCCCTGAAGATGGAG GACTTTTCTTACTGTGCTGCATAGACAGGGACTGGGCTGTCACTCGTTGTTTTGCAGAAGAAGCCTTTCA AGCAATCACTGACTTCAATGACCTCCCCAACTCGTTGTTTGCGTGCAATGTTCACCAGTCAGTGTTTGAA GGAGAAGAGAGCAAGGAAAAATTTGAGGGACTGTTTCGGACTTATGATGACTGTGTGACGTTCCAGCTAT TTAAGAGTTTCAGACGTGTCCGTATAAACTTCAGCAATCCTAAATCTGCAGCCCGAGCTAGGATAGAGCT TCATGAAACCCAATTCAGAGGGAAAAAATTAAAGCTCTACTTTGCACAGGTTCAGACTCCAGAGACAGAT GGAGACAAACTGCACTTGGCTCCACCCCAGCCTGCCAAACAGTTTCTCATCTCGCCCCCTTCCTCCCCAC CTGTTGGCTGGCAGCCCATCAACGATGCCACGCCAGTCCTCAACTATGACCTCCTCTATGCTGTGGCCAA ACTAGGACCAGGAGAGAAGTATGAGCTCCATGCAGGGACTGAGTCCACCCCAAGTGTCGTCGTGCACGTG TGCGACAGTGACATAGAGGAAGAAGAGGACCCAAAGACTTCCCCAAAGCCAAAAATCATCCAAACTCGGC GTCCTGGCCTGCCACCCTCCGTGTCCAACTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001251974 |
ORF Size | 732 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001251974.1, NP_001238903.1 |
RefSeq Size | 3316 |
RefSeq ORF | 732 |
Locus ID | 10231 |
Gene Summary | This gene encodes a member of the regulator of calcineurin (RCAN) protein family. These proteins play a role in many physiological processes by binding to the catalytic domain of calcineurin A, inhibiting calcineurin-mediated nuclear translocation of the transcription factor NFATC1. Expression of this gene in skin fibroblasts is upregulated by thyroid hormone, and the encoded protein may also play a role in endothelial cell function and angiogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2, also known as beta-1) differs in the 5' UTR and uses an alternate start codon, compared to variant 1. Variants 2 and 3 encode the same isoform (2, also known as beta), which is longer and has a distinct N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.