Geminin (GMNN) (NM_001251990) Human Untagged Clone

CAT#: SC330256

GMNN (untagged) - Homo sapiens geminin, DNA replication inhibitor (GMNN), transcript variant 3


  "NM_001251990" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "GMNN"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol GMNN
Synonyms Gem; MGORS6
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001251990, the custom clone sequence may differ by one or more nucleotides


ATGAATCCCAGTATGAAGCAGAAACAAGAAGAAATCAAAGAGAATATAAAGAATAGTTCTGTCCCAAGAA
GAACTCTGAAGATGATTCAGCCTTCTGCATCTGGATCTCTTGTTGGAAGAGAAAATGAGCTGTCCGCAGG
CTTGTCCAAAAGGAAACATCGGAATGACCACTTAACATCTACAACTTCCAGCCCTGGGGTTATTGTCCCA
GAATCTAGTGAAAATAAAAATCTTGGAGGAGTCACCCAGGAGTCATTTGATCTTATGATTAAAGAAAATC
CATCCTCTCAGTATTGGAAGGAAGTGGCAGAAAAACGGAGAAAGGCGCTGTATGAAGCACTTAAGGAAAA
TGAGAAACTTCATAAAGAAATTGAACAAAAGGACAATGAAATTGCCCGCCTGAAAAAGGAGAATAAAGAA
CTGGCAGAAGTAGCAGAACATGTACAGTATATGGCAGAGCTAATAGAGAGACTGAATGGTGAACCTCTGG
ATAATTTTGAATCACTGGATAATCAGGAATTTGATTCTGAAGAAGAAACTGTTGAGGATTCTCTAGTGGA
AGACTCAGAAATTGGCACGTGTGCTGAAGGAACTGTATCTTCCTCTACGGATGCAAAGCCATGTATATGA


Restriction Sites SgfI-MluI     
ACCN NM_001251990
ORF Size 630 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001251990.1, NP_001238919.1
RefSeq Size 1067
RefSeq ORF 630
Locus ID 51053
Protein Families Druggable Genome, Stem cell - Pluripotency
Gene Summary This gene encodes a protein that plays a critical role in cell cycle regulation. The encoded protein inhibits DNA replication by binding to DNA replication factor Cdt1, preventing the incorporation of minichromosome maintenance proteins into the pre-replication complex. The encoded protein is expressed during the S and G2 phases of the cell cycle and is degraded by the anaphase-promoting complex during the metaphase-anaphase transition. Increased expression of this gene may play a role in several malignancies including colon, rectal and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and two pseudogenes of this gene are located on the short arm of chromosome 16. [provided by RefSeq, Oct 2011]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.