Geminin (GMNN) (NM_001251990) Human Untagged Clone
CAT#: SC330256
GMNN (untagged) - Homo sapiens geminin, DNA replication inhibitor (GMNN), transcript variant 3
"NM_001251990" in other vectors (2)
Product Images
Other products for "GMNN"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | GMNN |
Synonyms | Gem; MGORS6 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001251990, the custom clone sequence may differ by one or more nucleotides
ATGAATCCCAGTATGAAGCAGAAACAAGAAGAAATCAAAGAGAATATAAAGAATAGTTCTGTCCCAAGAA GAACTCTGAAGATGATTCAGCCTTCTGCATCTGGATCTCTTGTTGGAAGAGAAAATGAGCTGTCCGCAGG CTTGTCCAAAAGGAAACATCGGAATGACCACTTAACATCTACAACTTCCAGCCCTGGGGTTATTGTCCCA GAATCTAGTGAAAATAAAAATCTTGGAGGAGTCACCCAGGAGTCATTTGATCTTATGATTAAAGAAAATC CATCCTCTCAGTATTGGAAGGAAGTGGCAGAAAAACGGAGAAAGGCGCTGTATGAAGCACTTAAGGAAAA TGAGAAACTTCATAAAGAAATTGAACAAAAGGACAATGAAATTGCCCGCCTGAAAAAGGAGAATAAAGAA CTGGCAGAAGTAGCAGAACATGTACAGTATATGGCAGAGCTAATAGAGAGACTGAATGGTGAACCTCTGG ATAATTTTGAATCACTGGATAATCAGGAATTTGATTCTGAAGAAGAAACTGTTGAGGATTCTCTAGTGGA AGACTCAGAAATTGGCACGTGTGCTGAAGGAACTGTATCTTCCTCTACGGATGCAAAGCCATGTATATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001251990 |
ORF Size | 630 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001251990.1, NP_001238919.1 |
RefSeq Size | 1067 |
RefSeq ORF | 630 |
Locus ID | 51053 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Gene Summary | This gene encodes a protein that plays a critical role in cell cycle regulation. The encoded protein inhibits DNA replication by binding to DNA replication factor Cdt1, preventing the incorporation of minichromosome maintenance proteins into the pre-replication complex. The encoded protein is expressed during the S and G2 phases of the cell cycle and is degraded by the anaphase-promoting complex during the metaphase-anaphase transition. Increased expression of this gene may play a role in several malignancies including colon, rectal and breast cancer. Alternatively spliced transcript variants have been observed for this gene, and two pseudogenes of this gene are located on the short arm of chromosome 16. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 2, 3 and 4 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.