PAPOLA (NM_001252006) Human Untagged Clone
CAT#: SC330258
PAPOLA (untagged) - Homo sapiens poly(A) polymerase alpha (PAPOLA), transcript variant 2
"NM_001252006" in other vectors (2)
Product Images
Other products for "PAPOLA"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | PAPOLA |
Synonyms | PAP; PAP-alpha |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001252006, the custom clone sequence may differ by one or more nucleotides
ATGCCGTTTCCAGTTACAACACAGGGATCACAACAAACACAACCGCCACAGAAGCACTATGGCATTACTT CTCCTATCAGCTTAGCAGCCCCCAAGGAGACTGACTGCGTACTTACACAGAAACTAATTGAGACATTGAA ACCCTTTGGGGTTTTTGAAGAGGAAGAGGAACTGCAGCGCAGGATTTTAATTTTGGGAAAACTAAATAAC CTGGTAAAAGAGTGGATACGAGAAATCAGTGAAAGCAAGAATCTTCCACAATCTGTAATTGAAAATGTTG GAGGAAAAATTTTTACATTTGGATCTTACAGATTAGGAGTGCATACAAAAGGTGCTGATATTGATGCGTT GTGTGTTGCACCAAGACATGTTGATCGAAGTGACTTTTTCACCTCATTCTATGATAAGTTGAAATTACAG GAAGAAGTAAAAGATTTAAGAGCTGTTGAAGAGGCATTCGTACCAGTTATTAAACTCTGTTTTGATGGGA TAGAGATTGATATTTTGTTTGCAAGATTAGCACTGCAGACAATTCCTGAAGATTTGGATCTACGAGATGA CAGTCTGCTAAAAAATTTAGATATAAGATGTATAAGAAGTCTTAACGGTTGCAGGGTAACCGATGAAATT TTACATCTAGTACCAAACATTGACAACTTCAGGTTAACTCTGAGAGCTATCAAACTATGGGCCAAACGCC ACAACATCTATTCCAATATATTAGGTTTCCTCGGTGGTGTTTCCTGGGCTATGCTAGTAGCAAGAACTTG CCAGCTTTATCCAAATGCAATAGCATCAACTCTTGTACATAAATTTTTCTTGGTATTTTCTAAATGGTAT GTGTTTAGATTATATTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252006 |
ORF Size | 858 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001252006.1, NP_001238935.1 |
RefSeq Size | 4013 |
RefSeq ORF | 858 |
Locus ID | 10914 |
Protein Families | Transcription Factors |
Protein Pathways | RNA degradation |
Gene Summary | The protein encoded by this gene belongs to the poly(A) polymerase family. It is required for the addition of adenosine residues for the creation of the 3'-poly(A) tail of mRNAs. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) lacks multiple exons and its transcription extends past a splice site that is used in variant 1, resulting in a novel 3' coding region and 3' UTR compared to variant 1. It encodes isoform 2 which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.