TOR2A (NM_001252018) Human Untagged Clone
CAT#: SC330261
TOR2A (untagged) - Homo sapiens torsin family 2, member A (TOR2A), transcript variant 6
"NM_001252018" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "TOR2A"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | TOR2A |
Synonyms | TORP1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001252018, the custom clone sequence may differ by one or more nucleotides
ATGGACAAGATGCCCCCAGGCCTGATGGAAGTCCTGCGGCCTTTCCTGGGCTCCTCCTGGGTGGTATACG GGACCAATTACCGCAAAGCCATCTTCATCTTCATCAGCAACACGGGTGGCGAGCAGATCAACCAGGTGGC ATTGGAGGCGTGGCGCAGCCGGCGGGACCGCGAGGAGATCCTCCTGCAGGAGCTGGAGCCGGTCATCTCC CGCGCGGTGCTGGACAACCCGCACCATGGCTTCTCAAACTCGGGCATCATGGAAGAGCGCCTCCTAGACG CAGTGGTGCCCTTCCTCCCGCTCCAGCGGCACCACGTCCGGCACTGCGTGCTCAACGAGCTGGCCCAGCT GGGCCTGGAGCCAAGGGATGAGGTTGTCCAGGCTGTGCTGGACAGCACCACCTTCTTCCCTGAAGACGAG CAGCTCTTCTCCTCCAACGGCTGCAAGACCGTGGCCTCCCGAATCGCCTTCTTCCTCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252018 |
ORF Size | 480 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001252018.1, NP_001238947.1 |
RefSeq Size | 1322 |
RefSeq ORF | 480 |
Locus ID | 27433 |
Protein Families | Secreted Protein, Transmembrane |
Gene Summary | This gene encodes a member of the AAA family of adenosine triphosphatases with similarity to Clp proteases and heat shock proteins. Alternative splicing at this locus results in the translation of multiple isoforms of the encoded protein, some of which contain salusin peptides in the C-terminal region. These peptides may play roles in hypotension, myocardial growth and the induction of mitogenesis, and may also be involved in the pathogenesis of atherosclerosis. The antimicrobial peptide salusin-beta has antibacterial activity. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (6) lacks an exon and uses a downstream, in-frame start codon, compared to variant 1. Variants 6 and 7 encode the same isoform (f), which has a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.