RAB5C (NM_001252039) Human Untagged Clone

CAT#: SC330267

RAB5C (untagged) - Homo sapiens RAB5C, member RAS oncogene family (RAB5C), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB5C
• Synonyms: L1880; RAB5CL; RAB5L; RABL
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252039, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAACTGAGTTGGAGGTCCCCCTCCCCACTAAGTGCCTCTTTGCATAGCACCAGTCCCCACCCGCACG
  CTCTCTGGACCACTACAGCTGGACGGGCAATGGCGGGTCGGGGAGGCGCAGCACGACCCAATGGACCAGC
  TGCTGGGAACAAGATCTGTCAATTTAAGCTGGTTCTGCTGGGGGAGTCTGCGGTAGGCAAATCCAGCCTC
  GTCCTCCGCTTTGTCAAGGGACAGTTTCACGAGTACCAGGAGAGCACAATTGGAGCGGCCTTCCTCACAC
  AGACTGTCTGCCTGGATGACACAACAGTCAAGTTTGAGATCTGGGACACAGCTGGACAGGAGCGGTATCA
  CAGCCTGGCCCCCATGTACTATCGGGGGGCCCAGGCTGCCATCGTGGTCTATGACATCACCAACACAGAT
  ACATTTGCACGGGCCAAGAACTGGGTGAAGGAGCTACAGAGGCAGGCCAGCCCCAACATCGTCATTGCAC
  TCGCGGGTAACAAGGCAGACCTGGCCAGCAAGAGAGCCGTGGAATTCCAGGAAGCACAAGCCTATGCAGA
  CGACAACAGTTTGCTGTTCATGGAGACATCAGCAAAGACTGCAATGAACGTGAACGAAATCTTCATGGCA
  ATAGCTAAGAAGCTTCCCAAGAACGAGCCCCAGAATGCAACTGGTGCTCCAGGCCGAAACCGAGGTGTGG
  ACCTCCAGGAGAACAACCCAGCCAGCCGGAGCCAGTGCTGCAGCAACTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252039
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252039.1, NP_001238968.1
• RefSeq Size: 1918 bp
• RefSeq ORF: 750 bp
• Locus ID: 5878
• Cytogenetics: 17q21.2
• Protein Families: Druggable Genome
• Protein Pathways: Endocytosis
• Gene Summary: 'Members of the Rab protein family are small GTPases of the Ras superfamily that are thought to ensure fidelity in the process of docking and/or fusion of vesicles with their correct acceptor compartment (Han et al., 1996 [PubMed 8646882]).[supplied by OMIM, Nov 2010]'
  Transcript Variant: This variant (3) differs in the 5' UTR, contains an alternate exon and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (b) is longer and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.