SLC9A3R2 (NM_001252073) Human Untagged Clone

CAT#: SC330268

SLC9A3R2 (untagged) - Homo sapiens solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 2 (SLC9A3R2), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: SLC9A3R2
• Synonyms: E3KARP; NHE3RF2; NHERF-2; NHERF2; OCTS2; SIP-1; SIP1; TKA-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252073, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCACGCTCCGGGAGTGCCACGCCACCTGCCCGGGCTCCGGGAGCCCCTCCACGGAGCCCACCCCAGA
  GGCTGGTACAGGATGTCAGTGGGCCCCTGAGGGAGCTGCGCCCTCGGCTCTGCCACCTGCGAAAGGGACC
  TCAGGGCTATGGGTTCAACCTGCATAGTGACAAGTCCCGGCCCGGCCAGTACATCCGCTCTGTGGACCCG
  GGCTCACCTGCCGCCCGCTCTGGCCTCCGCGCCCAGGACCGGCTCATTGAGGTGAACGGGCAGAATGTGG
  AGGGACTGCGCCATGCTGAGGTGGTGGCCAGCATCAAGGCACGGGAGGACGAGGCCCGGCTGCTGGTCGT
  GGACCCCGAGACAGATGAACACTTCAAGCGGCTTCGGGTCACACCCACCGAGGAGCACGTGGAAGGTCCT
  CTGCCGTCACCCGTCACCAATGGAACCAGCCCTGCCCAGCTCAATGGTGGCTCTGCGTGCTCGTCCCGAA
  GTGACCTGCCTGGTTCCGACAAGGACACTGAGGATGGCAGTGCCTGGAAGCAAGATCCCTTCCAGGAGAG
  CGGCCTCCACCTGAGCCCCACGGCGGCCGAGGCCAAGGAGAAGGCTCGAGCCATGCGAGTCAACAAGCGC
  GCGCCACAGATGGACTGGAACAGGAAGCGTGAAATCTTCAGCAACTTCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252073
• ORF Size: 681 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001252073.1, NP_001239002.1
• RefSeq Size: 1811
• RefSeq ORF: 681
• Locus ID: 9351
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the NHERF family of PDZ scaffolding proteins. These proteins mediate many cellular processes by binding to and regulating the membrane expression and protein-protein interactions of membrane receptors and transport proteins. The encoded protein plays a role in intestinal sodium absorption by regulating the activity of the sodium/hydrogen exchanger 3, and may also regulate the cystic fibrosis transmembrane regulator (CFTR) ion channel. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region and initiates translation at an alternate start codon, compared to variant 1. The encoded isoform (c) is shorter and has a distinct N-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.