USP15 (NM_001252079) Human Untagged Clone
CAT#: SC330269
USP15 (untagged) - Homo sapiens ubiquitin specific peptidase 15 (USP15), transcript variant 3
"NM_001252079" in other vectors (2)
Product Images
Other products for "USP15"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | USP15 |
| Synonyms | UNPH-2; UNPH4 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001252079, the custom clone sequence may differ by one or more nucleotides
ATGGCGGAAGGCGGAGCGGCGGATCTGGACACCCAGCGGTCTGACATCGCGACGCTGCTCAAAACCTCGC TCCGGAAAGGGGACACCTGGTACCTAGTCGATAGTCGCTGGTTCAAACAGTGGAAAAAATATGTTGGCTT TGACAGTTGGGACAAATACCAGATGGGAGATCAAAATGTGTATCCTGGACCCATTGATAACTCTGGACTT CTCAAAGATGGTGATGCCCAGTCACTTAAGGAACACCTTATTGATGAATTGGATTACATACTGTTGCCAA CTGAAGGTTGGAATAAACTTGTCAGCTGGTACACATTGATGGAAGGTCAAGAGCCAATAGCACGAAAGGT GGTTGAACAGGGTATGTTTGTAAAGCACTGCAAAGTAGAAGTATATCTCACAGAATTGAAGCTATGTGAA AATGGAAACATGAATAATGTTGTAACTCGAAGATTTAGCAAAGCTGACACAATAGATACAATTGAAAAGG AAATAAGAAAAATCTTCAGTATTCCAGATGAAAAGGAGACCAGATTGTGGAACAAATACATGAGTAACAC ATTTGAACCACTGAATAAACCAGACAGCACCATTCAGGATGCTGGTTTATACCAAGGACAGGTATTAGTG ATAGAACAGAAAAATGAAGATGGAACATGGCCAAGGGGTCCTTCTACTCCTAAAAAGCCACTAGAGCAGA GTTGCTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001252079 |
| ORF Size | 708 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Reference Data | |
| RefSeq | NM_001252079.1, NP_001239008.1 |
| RefSeq Size | 2286 |
| RefSeq ORF | 708 |
| Locus ID | 9958 |
| Protein Families | Druggable Genome, Protease |
| Gene Summary | This gene encodes a member of the ubiquitin specific protease (USP) family of deubiquitinating enzymes. USP enzymes play critical roles in ubiquitin-dependent processes through polyubiquitin chain disassembly and hydrolysis of ubiquitin-substrate bonds. The encoded protein associates with the COP9 signalosome, and also plays a role in transforming growth factor beta signalling through deubiquitination of receptor-activated SMAD transcription factors. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 2. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (3) differs in the 3' UTR and lacks a large portion of the 3' coding region, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China