TAFA1 (NM_001252216) Human Untagged Clone

CAT#: SC330278

FAM19A1 (untagged) - Homo sapiens family with sequence similarity 19 (chemokine (C-C motif)-like), member A1 (FAM19A1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: TAFA1
• Synonyms: FAM19A1; TAFA-1
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252216, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCAATGGTCTCTGCGATGTCCTGGGTCCTGTATTTGTGGATAAGTGCTTGTGCAATGCTACTCTGCC
  ATGGATCCCTTCAGCACACTTTCCAGCAGCATCACCTGCACAGACCAGAAGGAGGGACGTGTGAAGTGAT
  AGCAGCACACCGATGTTGTAACAAGAATCGCATTGAGGAGCGGTCACAAACAGTAAAGTGTTCCTGTCTA
  CCTGGAAAAGTGGCTGGAACAACAAGAAACCGGCCTTCTTGCGTCGATGCCTCCATAGTGATTGGGAAAT
  GGTGGTGTGAGATGGAGCCTTGCCTAGAAGGAGAAGAATGTAAGACACTCCCTGACAATTCTGGATGGAT
  GTGCGCAACAGGCAACAAAATTAAGACCACGAGAATTCACCCAAGAACCTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252216
• ORF Size: 402 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001252216.1, NP_001239145.1
• RefSeq Size: 1758
• RefSeq ORF: 402
• Locus ID: 407738
• Protein Families: Secreted Protein, Transmembrane
• Gene Summary: This gene is a member of the TAFA family which is composed of five highly homologous genes that encode small secreted proteins. These proteins contain conserved cysteine residues at fixed positions, and are distantly related to MIP-1alpha, a member of the CC-chemokine family. The TAFA proteins are predominantly expressed in specific regions of the brain, and are postulated to function as brain-specific chemokines or neurokines that act as regulators of immune and nervous cells. [provided by RefSeq, Jul 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.