NT5C (NM_001252377) Human Untagged Clone
CAT#: SC330285
NT5C (untagged) - Homo sapiens 5', 3'-nucleotidase, cytosolic (NT5C), transcript variant 2
"NM_001252377" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "NT5C"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | NT5C |
Synonyms | cdN; DNT; dNT-1; DNT1; HEL74; P5N2; PN-I; PN-II; UMPH2 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001252377, the custom clone sequence may differ by one or more nucleotides
ATGGCGCGGAGCGTGCGCGTGCTGGTGGACATGGACGGCGTCCTGGCCGACTTCGAGGCCGGCCTCCTGC GGGGCTTCCGCCGCCGCTTCCCTGAGGAGCCGCACGTGCCGCTGGAGCAACGCCGCGGCTTCCTGGCCCG CGAGCAGTACCGCGCCCTGCGGCCCGACCTGGCGGATAAAGTGGCCAGTGTGTACGAAGCCCCGGGCTTT TTCCTGGACCTGGAGCCCATCCCGGGAGCCTTGGACGCTGTGCGGGAGATGAACGACCTACCGGACACGC AGGTCTTCATCTGCACCAGCCCCCTGCTGAAGTACCACCACTGTGTGGGTGAGAAGGAGGAGACCCCAAG CTGGGAGCACATCTTGTTCACCTGCTGCCACAATCGGCACCTGGTCCTGCCCCCGACAAGGAGACGGCTG CTCTCCTGGAGTGACAACTGGAGGGAGATCTTAGATAGCAAGCGCGGAGCTGCGCAGCGGGAATGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252377 |
ORF Size | 486 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001252377.1, NP_001239306.1 |
RefSeq Size | 855 |
RefSeq ORF | 486 |
Locus ID | 30833 |
Protein Families | Transcription Factors |
Protein Pathways | Metabolic pathways, Nicotinate and nicotinamide metabolism, Purine metabolism, Pyrimidine metabolism |
Gene Summary | This gene encodes a nucleotidase that catalyzes the dephosphorylation of the 5' deoxyribonucleotides (dNTP) and 2'(3')-dNTP and ribonucleotides, but not 5' ribonucleotides. Of the different forms of nucleotidases characterized, this enzyme is unique in its preference for 5'-dNTP. It may be one of the enzymes involved in regulating the size of dNTP pools in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2011] Transcript Variant: This variant (2) lacks an in-frame coding exon, and uses an alternate in-frame acceptor splice site at the 3' terminal exon compared to variant 1. This results in a shorter isoform (2) missing an internal protein segment compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.