hCG (CGA) (NM_001252383) Human Untagged Clone

CAT#: SC330286

CGA (untagged) - Homo sapiens glycoprotein hormones, alpha polypeptide (CGA), transcript variant 1

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CGA
• Synonyms: CG-ALPHA; FSHA; GPA1; GPHa; GPHA1; HCG; LHA; TSHA
• Vector: PCMV6-Neo
• E. coli Selection: Ampicillin (100 ug/mL)
• Mammalian Cell Selection: Neomycin
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252383, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATTACTACAGAAAATATGCAGCTATCTTTCTGGTCACATTGTCGGTGTTTCTGCATGTTCTCCATT
  CCGCTCCTGATGTGCAGGAGACAGGGTTTCACCATGTTGCCCAGGCTGCTCTCAAACTCCTGAGCTCAAG
  CAATCCACCCACTAAGGCCTCCCAAAGTGCTAGGATTACAGATTGCCCAGAATGCACGCTACAGGAAAAC
  CCATTCTTCTCCCAGCCGGGTGCCCCAATACTTCAGTGCATGGGCTGCTGCTTCTCTAGAGCATATCCCA
  CTCCACTAAGGTCCAAGAAGACGATGTTGGTCCAAAAGAACGTCACCTCAGAGTCCACTTGCTGTGTAGC
  TAAATCATATAACAGGGTCACAGTAATGGGGGGTTTCAAAGTGGAGAACCACACGGCGTGCCACTGCAGT
  ACTTGTTATTATCACAAATCTTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252383
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001252383.1, NP_001239312.1
• RefSeq Size: 861 bp
• RefSeq ORF: 444 bp
• Locus ID: 1081
• Cytogenetics: 6q14.3
• Protein Families: Druggable Genome, ES Cell Differentiation/IPS, Secreted Protein
• Protein Pathways: Autoimmune thyroid disease, GnRH signaling pathway, Neuroactive ligand-receptor interaction
• Gene Summary: 'The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. The protein encoded by this gene is the alpha subunit and belongs to the glycoprotein hormones alpha chain family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]'
  Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1).