RHNO1 (NM_001252500) Human Untagged Clone
CAT#: SC330289
RHNO1 (untagged) - Homo sapiens RAD9-HUS1-RAD1 interacting nuclear orphan 1 (RHNO1), transcript variant 2
"NM_001252500" in other vectors (2)
Product Images
Other products for "RHNO1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | RHNO1 |
Synonyms | C12orf32; HKMT1188; RHINO |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001252500, the custom clone sequence may differ by one or more nucleotides
ATGCCTCCCAGAAAAAAACGCCGCCAGCCTTCCCAGAAAGCCCCGCTGCTGTTCCACCAACAACCACTGG AGGGCCCCAAACACAGCTGTGCATCTACACAGCTTCCCATCACTCACACTCGACAGGTATCACCTGATTT TGATACAGCAGCAGGAAGCTTGTTCCCAGCCTACCAGAAACACCAAAACCGGGCGAGACACTCAAGTCGA AAACCTACCACCTCCAAGTTTCCACATCTAACTTTTGAGAGTCCGCAATCTTCCAGTTCAGAGACATTGG GGATCCCCTTAATCCGAGAGTGCCCCAGTGAATCAGAAAAGGATGTTTCCAGAAGACCCTTAGTTCCAGT GCTCAGTCCCCAAAGCTGTGGGAACATGTCAGTGCAGGCACTTCAGAGCTTACCTTATGTGTTCATTCCA CCTGATATCCAGACCCCAGAGTCATCGTCTGTGAAGGAAGAACTCATTCCCCAAGATCAGAAGGAAAACA GCCTTCTAAGCTGCACTCTTCACACTGGCACTCCTAATAGCCCAGAGCCTGGACCTGTTCTGGTTAAAGA CACCCCCGAGGACAAGTATGGAATAAAGGTCACATGGAGGAGACGACAGCACCTGCTTGCTTACCTCAGG GAGAGAGGGAAGCTGAGCAGAAGCCAATTCCTTGTGAAAAGCTGA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001252500 |
ORF Size | 675 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001252500.2, NP_001239429.1 |
RefSeq Size | 1920 |
RefSeq ORF | 675 |
Locus ID | 83695 |
Gene Summary | Plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. Recruited to sites of DNA damage through interaction with the 9-1-1 cell-cycle checkpoint response complex and TOPBP1 in a ATR-dependent manner. Required for the progression of the G1 to S phase transition. Plays a role in the stimulation of CHEK1 phosphorylation. [UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.