RHNO1 (NM_001252500) Human Untagged Clone

CAT#: SC330289

RHNO1 (untagged) - Homo sapiens RAD9-HUS1-RAD1 interacting nuclear orphan 1 (RHNO1), transcript variant 2


  "NM_001252500" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RHNO1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RHNO1
Synonyms C12orf32; HKMT1188; RHINO
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001252500, the custom clone sequence may differ by one or more nucleotides


ATGCCTCCCAGAAAAAAACGCCGCCAGCCTTCCCAGAAAGCCCCGCTGCTGTTCCACCAACAACCACTGG
AGGGCCCCAAACACAGCTGTGCATCTACACAGCTTCCCATCACTCACACTCGACAGGTATCACCTGATTT
TGATACAGCAGCAGGAAGCTTGTTCCCAGCCTACCAGAAACACCAAAACCGGGCGAGACACTCAAGTCGA
AAACCTACCACCTCCAAGTTTCCACATCTAACTTTTGAGAGTCCGCAATCTTCCAGTTCAGAGACATTGG
GGATCCCCTTAATCCGAGAGTGCCCCAGTGAATCAGAAAAGGATGTTTCCAGAAGACCCTTAGTTCCAGT
GCTCAGTCCCCAAAGCTGTGGGAACATGTCAGTGCAGGCACTTCAGAGCTTACCTTATGTGTTCATTCCA
CCTGATATCCAGACCCCAGAGTCATCGTCTGTGAAGGAAGAACTCATTCCCCAAGATCAGAAGGAAAACA
GCCTTCTAAGCTGCACTCTTCACACTGGCACTCCTAATAGCCCAGAGCCTGGACCTGTTCTGGTTAAAGA
CACCCCCGAGGACAAGTATGGAATAAAGGTCACATGGAGGAGACGACAGCACCTGCTTGCTTACCTCAGG
GAGAGAGGGAAGCTGAGCAGAAGCCAATTCCTTGTGAAAAGCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001252500
ORF Size 675 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001252500.2, NP_001239429.1
RefSeq Size 1920
RefSeq ORF 675
Locus ID 83695
Gene Summary Plays a role in DNA damage response (DDR) signaling upon genotoxic stresses such as ionizing radiation (IR) during the S phase. Recruited to sites of DNA damage through interaction with the 9-1-1 cell-cycle checkpoint response complex and TOPBP1 in a ATR-dependent manner. Required for the progression of the G1 to S phase transition. Plays a role in the stimulation of CHEK1 phosphorylation. [UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site in the central coding region, compared to variant 1, resulting in a shorter isoform (2), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.