CED6 (GULP1) (NM_001252669) Human Untagged Clone

CAT#: SC330293

GULP1 (untagged) - Homo sapiens GULP, engulfment adaptor PTB domain containing 1 (GULP1), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: GULP1
• Synonyms: CED-6; CED6; GULP
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001252669, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAACCGTGCTTTTAGCAGGAAGAAAGACAAAACATGGATGCATACACCTGAAGCTTTATCAAAACATT
  TCATTCCCTATAATGCAAAGGCTGAAGAGATCACTTTAACAATTGGCCAAGCATTTGACCTGGCATACAG
  GAAATTTCTAGAATCAGGAGGAAAAGATGTTGAAACAAGAAAACAGATCGCAGGGTTACAAAAAAGAATC
  CAAGACTTAGAAACAGAAAATATGGAACTTAAAAATAAAGTACAAGATTTGGAAAACCAACTGAGAATAA
  CTCAAGTATCAGCACCTCCAGCAGGCAGTATGACACCTAAGTCGCCCTCCACTGACATCTTTGATATGAT
  TCCATTTTCTCCAATATCACACCAGTCTTCGATGCCTACTCGCAATGGCACACAGCCACCTCCAGTACCT
  AGTAGATCTACTGAGATTAAACGGGACCTGTTTGGAGCAGAACCTTTTGACCCATTTAACTGTGGAGCAG
  CAGATTTCCCTCCAGATATTCAATCAAAATTAGATGAGATGCAGGAGGGGTTCAAAATGGGACTAACTCT
  TGAAGGCACAGTATTTTGTCTCGACCCGTTAGACAGTAGGTGCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001252669
• ORF Size: 606 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001252669.1, NP_001239598.1
• RefSeq Size: 3203
• RefSeq ORF: 606
• Locus ID: 51454
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is an adapter protein necessary for the engulfment of apoptotic cells by phagocytes. Several transcript variants, some protein coding and some thought not to be protein coding, have been found for this gene. [provided by RefSeq, Nov 2011]
  Transcript Variant: This variant (3) lacks an alternate in-frame coding segment compared to variant 1. The resulting isoform (c) has the same N- and C-termini but is shorter compared to isoform a.