Biliverdin Reductase (BLVRA) (NM_001253823) Human Untagged Clone
CAT#: SC330309
BLVRA (untagged) - Homo sapiens biliverdin reductase A (BLVRA), transcript variant 2
"NM_001253823" in other vectors (2)
Product Images
Other products for "BLVRA"
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Symbol | BLVRA |
| Synonyms | BLVR; BVR; BVRA |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001253823, the custom clone sequence may differ by one or more nucleotides
ATGAATGCAGAGCCCGAGAGGAAGTTTGGCGTGGTGGTGGTTGGTGTTGGCCGAGCCGGCTCCGTGCGGA TGAGGGACTTGCGGAATCCACACCCTTCCTCAGCGTTCCTGAACCTGATTGGCTTCGTGTCGAGAAGGGA GCTCGGGAGCATTGATGGAGTCCAGCAGATTTCTTTGGAGGATGCTCTTTCCAGCCAAGAGGTGGAGGTC GCCTATATCTGCAGTGAGAGCTCCAGCCATGAGGACTACATCAGGCAGTTCCTTAATGCTGGCAAGCACG TCCTTGTGGAATACCCCATGACACTGTCATTGGCGGCCGCTCAGGAACTGTGGGAGCTGGCTGAGCAGAA AGGAAAAGTCTTGCACGAGGAGCATGTTGAACTCTTGATGGAGGAATTCGCTTTCCTGAAAAAAGAAGTG GTGGGGAAAGACCTGCTGAAAGGGTCGCTCCTCTTCACAGCTGGCCCGTTGGAAGAAGAGCGGTTTGGCT TCCCTGCATTCAGCGGCATCTCTCGCCTGACCTGGCTGGTCTCCCTCTTTGGGGAGCTTTCTCTTGTGTC TGCCACTTTGGAAGAGCGAAAGGAAGATCAGTATATGAAAATGACAGTGTGTCTGGAGACAGAGAAGAAA AGTCCACTGTCATGGATTGAAGAAAAAGGACCTGGTCTAAAACGAAACAGATATTTAAGCTTCCATTTCA AGTCTGGGTCCTTGGAGAATGTGCCAAATGTAGGAGTGAATAAGAACATATTTCTGAAAGATCAAAATAT ATTTGTCCAGAAACTCTTGGGCCAGTTCTCTGAGAAGGAACTGGCTGCTGAAAAGAAACGCATCCTGCAC TGCCTGGGGCTTGCAGAAGAAATCCAGAAATATTGCTGTTCAAGGAAGTAA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001253823 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001253823.1, NP_001240752.1 |
| RefSeq Size | 1191 bp |
| RefSeq ORF | 891 bp |
| Locus ID | 644 |
| Cytogenetics | 7p13 |
| Protein Pathways | Porphyrin and chlorophyll metabolism |
| Gene Summary | 'The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]' Transcript Variant: This variant (2) contains an additional 5' non-coding exon compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.
Germany
Japan
United Kingdom
China