Biliverdin Reductase (BLVRA) (NM_001253823) Human Untagged Clone

CAT#: SC330309

BLVRA (untagged) - Homo sapiens biliverdin reductase A (BLVRA), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: BLVRA
• Synonyms: BLVR; BVR; BVRA
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001253823, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGAATGCAGAGCCCGAGAGGAAGTTTGGCGTGGTGGTGGTTGGTGTTGGCCGAGCCGGCTCCGTGCGGA
  TGAGGGACTTGCGGAATCCACACCCTTCCTCAGCGTTCCTGAACCTGATTGGCTTCGTGTCGAGAAGGGA
  GCTCGGGAGCATTGATGGAGTCCAGCAGATTTCTTTGGAGGATGCTCTTTCCAGCCAAGAGGTGGAGGTC
  GCCTATATCTGCAGTGAGAGCTCCAGCCATGAGGACTACATCAGGCAGTTCCTTAATGCTGGCAAGCACG
  TCCTTGTGGAATACCCCATGACACTGTCATTGGCGGCCGCTCAGGAACTGTGGGAGCTGGCTGAGCAGAA
  AGGAAAAGTCTTGCACGAGGAGCATGTTGAACTCTTGATGGAGGAATTCGCTTTCCTGAAAAAAGAAGTG
  GTGGGGAAAGACCTGCTGAAAGGGTCGCTCCTCTTCACAGCTGGCCCGTTGGAAGAAGAGCGGTTTGGCT
  TCCCTGCATTCAGCGGCATCTCTCGCCTGACCTGGCTGGTCTCCCTCTTTGGGGAGCTTTCTCTTGTGTC
  TGCCACTTTGGAAGAGCGAAAGGAAGATCAGTATATGAAAATGACAGTGTGTCTGGAGACAGAGAAGAAA
  AGTCCACTGTCATGGATTGAAGAAAAAGGACCTGGTCTAAAACGAAACAGATATTTAAGCTTCCATTTCA
  AGTCTGGGTCCTTGGAGAATGTGCCAAATGTAGGAGTGAATAAGAACATATTTCTGAAAGATCAAAATAT
  ATTTGTCCAGAAACTCTTGGGCCAGTTCTCTGAGAAGGAACTGGCTGCTGAAAAGAAACGCATCCTGCAC
  TGCCTGGGGCTTGCAGAAGAAATCCAGAAATATTGCTGTTCAAGGAAGTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253823
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001253823.1, NP_001240752.1
• RefSeq Size: 1191 bp
• RefSeq ORF: 891 bp
• Locus ID: 644
• Cytogenetics: 7p13
• Protein Pathways: Porphyrin and chlorophyll metabolism
• Gene Summary: 'The protein encoded by this gene belongs to the biliverdin reductase family, members of which catalyze the conversion of biliverdin to bilirubin in the presence of NADPH or NADH. Mutations in this gene are associated with hyperbiliverdinemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2011]'
  Transcript Variant: This variant (2) contains an additional 5' non-coding exon compared to variant 1. Variants 1 and 2 encode the same protein.