AKR1C3 (NM_001253908) Human Untagged Clone

CAT#: SC330316

AKR1C3 (untagged) - Homo sapiens aldo-keto reductase family 1, member C3 (AKR1C3), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: AKR1C3
• Synonyms: DD3; DDX; HA1753; HAKRB; HAKRe; hluPGFS; HSD17B5; PGFS
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001253908, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGATTCAAAACATCAGTGTTTGAAGCTAAATGATGGTCACTTCATGCCTGTCCTGGGATTTGGCACCT
  ATGCACCTCCAGAGGTTCCGAGAAGTAAAGCTTTGGAGGTCACAAAATTAGCAATAGAAGCTGGGTTCCG
  CCATATAGATTCTGCTCATTTATACAATAATGAGGAGCAGGTTGGACTGGCCATCCGAAGCAAGATTGCA
  GATGGCAGTGTGAAGAGAGAAGACATATTCTACACTTCAAAGCTTTGGTCCACTTTTCATCGACCAGAGT
  TGGTCCGACCAGCCTTGGAAAACTCACTGAAGAAAGCTCAATTGGACTATGTTGACCTCTATCTTATTCA
  TTCTCCAATGTCTCTAAAGCCAGGTGAGGAACTTTCACCAACAGATGAAAATGGAAAAGTAATATTTGAC
  ATAGTGGATCTCTGTACCACCTGGGAGGCCATGGAGAAGTGTAAGGATGCAGGATTGGCCAAGTCCATTG
  GGGTGTCAAACTTCAACCGCAGGCAGCTGGAGATGATCCTCAACAAGCCAGGACTCAAGTACAAGCCTGT
  CTGCAACCAGGTAGAATGTCATCCGTATTTCAACCGGAGTAAATTGCTAGATTTCTGCAAGTCGAAAGAT
  ATTGTTCTGGTTGCCTATAGTGCTCTGGGATCTCAACGAGACAAACGATGGGTGGACCCGAACTCCCCGG
  TGCTCTTGGAGGACCCAGTCCTTTGTGCCTTGGCAAAAAAGCACAAGCGAACCCCAGCCCTGATTGCCCT
  GCGCTACCAGCTGCAGCGTGGGGTTGTGGTCCTGGCCAAGAGCTACAATGAGCAGCGCATCAGACAGAAC
  GTGCAGGTTTTTGAGTTCCAGTTGACTGCAGAGGACATGAAAGCCATAGATGGCCTAGACAGAAATCTCC
  ACTATTTTAACAGTGATAGTTTTGCTAGCCACCCTAATTATCCATATTCAGATGAATATTAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001253908
• ORF Size: 972 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001253908.1, NP_001240837.1
• RefSeq Size: 1228
• RefSeq ORF: 972
• Locus ID: 8644
• Protein Families: Druggable Genome
• Protein Pathways: Arachidonic acid metabolism, Metabolism of xenobiotics by cytochrome P450
• Gene Summary: This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the reduction of prostaglandin (PG) D2, PGH2 and phenanthrenequinone (PQ), and the oxidation of 9alpha,11beta-PGF2 to PGD2. It may play an important role in the pathogenesis of allergic diseases such as asthma, and may also have a role in controlling cell growth and/or differentiation. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (2) differs in the 5' UTR and coding sequence compared to variant 1. The resulting isoform (2) is the same length as isoform 1 but differs by 1 aa in the N-terminus.