NABP1 (NM_001254736) Human Untagged Clone

CAT#: SC330323

NABP1 (untagged) - Homo sapiens nucleic acid binding protein 1 (NABP1), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: NABP1
• Synonyms: OBFC2A; SOSS-B2; SSB2
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001254736, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTGGAAAGGATGTCTGACACTTTATACTGGAAGGGGTGGTGAACTTCAAAAAATTGGGGAATTTTGTA
  TGGTTTATTCAGAAGTGCCAAATTTCAGTGAACCCAACCCAGATTATCGAGGACAGCAGAACAAAGGGGC
  ACAGAGTGAACAGAAGAATAATTCCATGAATAGTAATATGGGTACAGGTACATTTGGACCAGTGGGAAAT
  GGTGTTCACACTGGCCCTGAATCAAGGGAACACCAGTTTTCACATGCTGGCAGAAGCAATGGCCGGGGAC
  TTATAAATCCACAACTACAAGGAACAGCTAGTAATCAAACAGTGATGACCACAATAAGTAATGGCAGGGA
  CCCTCGGAGAGCCTTTAAAAGATGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001254736
• ORF Size: 375 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001254736.1, NP_001241665.1
• RefSeq Size: 3465
• RefSeq ORF: 375
• Locus ID: 64859
• Gene Summary: Single-stranded DNA (ssDNA)-binding proteins, such as OBFC2A, are ubiquitous and essential for a variety of DNA metabolic processes, including replication, recombination, and detection and repair of damage (Richard et al., 2008 [PubMed 18449195]). [supplied by OMIM, Jun 2008]
  Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1.