RGS5 (NM_001254748) Human Untagged Clone

CAT#: SC330327

RGS5 (untagged) - Homo sapiens regulator of G-protein signaling 5 (RGS5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RGS5
• Synonyms: MST092; MST106; MST129; MSTP032; MSTP092; MSTP106; MSTP129
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001254748, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCTGAGAAGGCAAAGCAAATTTATGAAGAATTCATTCAAACGGAGGCTCCTAAAGAGGTGAATATTG
  ACCACTTCACTAAGGACATCACAATGAAGAACCTGGTGGAACCTTCCCTGAGCAGCTTTGACATGGCCCA
  GAAAAGAATCCATGCCCTGATGGAAAAGGATTCTCTGCCTCGCTTTGTGCGCTCTGAGTTTTATCAGGAG
  TTAATCAAGTAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001254748
• ORF Size: 222 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001254748.1, NP_001241677.1
• RefSeq Size: 5822
• RefSeq ORF: 222
• Locus ID: 8490
• Protein Families: Druggable Genome
• Gene Summary: This gene encodes a member of the regulators of G protein signaling (RGS) family. The RGS proteins are signal transduction molecules which are involved in the regulation of heterotrimeric G proteins by acting as GTPase activators. This gene is a hypoxia-inducible factor-1 dependent, hypoxia-induced gene which is involved in the induction of endothelial apoptosis. This gene is also one of three genes on chromosome 1q contributing to elevated blood pressure. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 1. The encoded isoform (2, also known as RGS5s), which is localized almost exclusively to the cytosolic fraction, is shorter at the N-terminus, compared to isoform 1. Both variants 2 and 3 encode isoform 2. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.