UQCRB (NM_001254752) Human Untagged Clone

CAT#: SC330328

UQCRB (untagged) - Homo sapiens ubiquinol-cytochrome c reductase binding protein (UQCRB), transcript variant 3


  "NM_001254752" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "UQCRB"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol UQCRB
Synonyms MC3DN3; QCR7; QP-C; QPC; UQBC; UQBP; UQCR6; UQPC
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001254752, the custom clone sequence may differ by one or more nucleotides


ATGGCTGGTAAGCAGGCCGTTTCAGCATCAGGCAAGTGGCTGGATGGTATTCGAAAATGGTATTACAATG
CTGCAGGATTCAATAAACTGGGGTTAATGCGAGATGATACAATATACGAGGATGAAGATGTAAAAGAAGC
CATAAGAAGACTTCCTGAGAACCTTTATAATGACAGGATGTTTCGCATTAAGAGGGCACTGGACCTGAAC
TTGAAGCATCAGATCTTGCCTAAAGAGCAGTGGACCAAATATGAAGAGGTCTTTGCTGTTCCAGCTCTGC
ACTCTGCTTCCTACTTAGATGAAAAGATCAGCCCATTGAGTGTCCCTCCAGATCCCAAGAAGAGCTTCTG
TGAAGCAAACTCTCACCCCTTGAACTGCATTGAAACTAGGCAAAGGAAAATTTCTACCTTGAACCGTATC
TGA


Restriction Sites SgfI-MluI     
ACCN NM_001254752
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001254752.1, NP_001241681.1
RefSeq Size 4976 bp
RefSeq ORF 423 bp
Locus ID 7381
Cytogenetics 8q22.1
Protein Pathways Alzheimer's disease, Cardiac muscle contraction, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease
Gene Summary 'This gene encodes a subunit of the ubiquinol-cytochrome c oxidoreductase complex, which consists of one mitochondrial-encoded and 10 nuclear-encoded subunits. The protein encoded by this gene binds ubiquinone and participates in the transfer of electrons when ubiquinone is bound. This protein plays an important role in hypoxia-induced angiogenesis through mitochondrial reactive oxygen species-mediated signaling. Mutations in this gene are associated with mitochondrial complex III deficiency. Alternatively spliced transcript variants have been found for this gene. Related pseudogenes have been identified on chromosomes 1, 5 and X. [provided by RefSeq, Dec 2011]'
Transcript Variant: This variant (3) contains an additional exon that results in a frameshift in the 3' coding region, compared to variant 1. The encoded isoform (3) has a distinct C-terminus and is longer than isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.