IFT43 (NM_001255995) Human Untagged Clone

CAT#: SC330343

IFT43 (untagged) - Homo sapiens intraflagellar transport 43 homolog (Chlamydomonas) (IFT43), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: IFT43
• Synonyms: C14orf179; CED3; RP81; SRTD18
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001255995, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGAGGATTTGCTCGACTTGGACGAGGAGCTTCGCTACAGCTTGGCTACCTCCAGGGCCAAGATGGGTC
  GCCGAGCTCAACAGGAGTCAGCGCAGGCCGAGAATCACCTCAATGGCAAGAATTCCTCTTTGACTCTGAC
  TGGAGAGACTTCCTCTGCTAAATTACCTCGCTGCCGACAGGGAGGCTGGGCAGGTGATTCCGTGAAGGCT
  TCGAAGTTTAGGAGGAAGGCTTCTGAAGAAATAGAAGAGTACGTTTCCAGTATTCTTATTCTTATGGTAT
  CCTATGTTGATCTTGGTCAACAGTGCAGTCTTGGTGGTCATGATCTGTTCCACCTATGTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001255995
• ORF Size: 342 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001255995.1, NP_001242924.1
• RefSeq Size: 911
• RefSeq ORF: 342
• Locus ID: 112752
• Gene Summary: This gene encodes a subunit of the intraflagellar transport complex A (IFT-A). IFT-A is a multiprotein complex that plays an important role in cilia assembly and maintenance by mediating retrograde ciliary transport. Mutations in this gene are a cause of cranioectodermal dysplasia-3 (CED3), also known as Sensenbrenner syndrome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) differs in the 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.