CLIC5 (NM_001256023) Human Untagged Clone
CAT#: SC330350
CLIC5 (untagged) - Homo sapiens chloride intracellular channel 5 (CLIC5), transcript variant 3
"NM_001256023" in other vectors (2)
Product Images
![](https://cdn.origene.com/img/defaults-img-expression-plasmids.jpg)
Other products for "CLIC5"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CLIC5 |
Synonyms | DFNB102; DFNB103; MST130; MSTP130 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256023, the custom clone sequence may differ by one or more nucleotides
ATGACAGACTCGGCGACAGCTAACGGGGACGACAGGGACCCCGAGATCGAGCTCTTTGTGAAGGCTGGAA TCGATGGAGAAAGCATCGGCAACTGTCCTTTCTCTCAGCGCCTCTTCATGATCCTCTGGCTGAAAGGAGT CGTGTTCAATGTCACCACTGTGGATCTGAAAAGAAAGCCAGCTGACCTGCACAACCTAGCCCCCGGCACG CACCCGCCCTTCCTGACCTTCAACGGGGACGTGAAGACAGACGTCAATAAGATCGAGGAGTTCCTGGAGG AGACCTTGACCCCTGAAAAGTACCCCAAACTGGCTGCAAAACACCGGGAATCCAACACAGCGGGCATCGA CATCTTTTCCAAGTTTTCTGCCTACATCAAAAATACCAAGCAGCAGAACAATGCTGCTCTTGAAAGAGGC CTAACCAAGGCTCTAAAGAAATTGGATGACTACCTGAACACCCCTCTACCAGAGGAGATTGACGCCAACA CTTGTGGGGAAGACAAGGGGTCCCGGCGCAAGTTCCTGGATGGGGATGAGCTGACCCTGGCTGACTGCAA TCTGTTGCCCAAGCTCCATGTGGTCAAGGAACAAGTACCACTGAAAGGGATGATATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256023 |
ORF Size | 618 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001256023.1, NP_001242952.1 |
RefSeq Size | 2067 |
RefSeq ORF | 618 |
Locus ID | 53405 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (3) differs in the 5' and 3' UTRs and initiates translation at an alternate start codon, compared to variant 1. the encoded isoform (c) is shorter and has distinct N- and C-termini, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.