CLIC5 (NM_001256023) Human Untagged Clone

CAT#: SC330350

CLIC5 (untagged) - Homo sapiens chloride intracellular channel 5 (CLIC5), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: CLIC5
• Synonyms: DFNB102; DFNB103; MST130; MSTP130
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256023, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGACAGACTCGGCGACAGCTAACGGGGACGACAGGGACCCCGAGATCGAGCTCTTTGTGAAGGCTGGAA
  TCGATGGAGAAAGCATCGGCAACTGTCCTTTCTCTCAGCGCCTCTTCATGATCCTCTGGCTGAAAGGAGT
  CGTGTTCAATGTCACCACTGTGGATCTGAAAAGAAAGCCAGCTGACCTGCACAACCTAGCCCCCGGCACG
  CACCCGCCCTTCCTGACCTTCAACGGGGACGTGAAGACAGACGTCAATAAGATCGAGGAGTTCCTGGAGG
  AGACCTTGACCCCTGAAAAGTACCCCAAACTGGCTGCAAAACACCGGGAATCCAACACAGCGGGCATCGA
  CATCTTTTCCAAGTTTTCTGCCTACATCAAAAATACCAAGCAGCAGAACAATGCTGCTCTTGAAAGAGGC
  CTAACCAAGGCTCTAAAGAAATTGGATGACTACCTGAACACCCCTCTACCAGAGGAGATTGACGCCAACA
  CTTGTGGGGAAGACAAGGGGTCCCGGCGCAAGTTCCTGGATGGGGATGAGCTGACCCTGGCTGACTGCAA
  TCTGTTGCCCAAGCTCCATGTGGTCAAGGAACAAGTACCACTGAAAGGGATGATATAA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256023
• ORF Size: 618 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256023.1, NP_001242952.1
• RefSeq Size: 2067
• RefSeq ORF: 618
• Locus ID: 53405
• Protein Families: Druggable Genome, Ion Channels: Other
• Gene Summary: This gene encodes a member of the chloride intracellular channel (CLIC) family of chloride ion channels. The encoded protein associates with actin-based cytoskeletal structures and may play a role in multiple processes including hair cell stereocilia formation, myoblast proliferation and glomerular podocyte and endothelial cell maintenance. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
  Transcript Variant: This variant (3) differs in the 5' and 3' UTRs and initiates translation at an alternate start codon, compared to variant 1. the encoded isoform (c) is shorter and has distinct N- and C-termini, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.