ATF2 (NM_001256092) Human Untagged Clone

CAT#: SC330362

ATF2 (untagged) - Homo sapiens activating transcription factor 2 (ATF2), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: ATF2
• Synonyms: CRE-BP1; CREB-2; CREB2; HB16; TREB7
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256092, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGTACTGCGCCTGGATGTGGCCAGATCAGACCCCAACACCAACAAGATTCTTGAAAAACTGTGAAGAAG
  TGGGTTTGTTTAATGAGTTGGCGAGTCCATTTGAGAATGAATTCAAGAAAGCTTCAGAAGATGACATTAA
  AAAAATGCCTCTAGATTTATCCCCTCTTGCAACACCTATCATAAGAAGCAAAATTGAGGAGCCTTCTGTT
  GTAGAAACAACTCACCAGGATAGTCCTTTACCTCACCCAGAGTCTACTACCAGTGATGAGAAGGAAGTAC
  CATTGGCACAAACTGCACAGCCCACATCAGCTATTGTTCGTCCAGCATCATTACAGGTTCCCAATGTGCT
  GCTTACAAGTTCTGACTCAAGTGTAATTATTCAGCAGGCAGTACCTTCACCAACCTCAAGTACTGTAATC
  ACCCAGGCACCATCCTCTAACAGGCCAATTGTCCCTGTACCAGGCCCATTTCCTCTTCTGTTACATCTTC
  CTAATGGACAAACCATGCCTGTTGCTATTCCTGCATCAATTACAAGTTCTAATGTGCATGTTCCAGCTGC
  AGTCCCACTCGTTCGACCAGTCACCATGGTGCCTAGTGTTCCAGGAATCCCAGGTCCTTCCTCTCCCCAA
  CCAGTACAGTCAGAAGCAAAAATGAGATTAAAAGCTGCTTTGACCCAGCAACATCCTCCAGTTACCAATG
  GTGATACTGTCAAAGGTCATGGTAGCGGATTGGTTAGGACTCAGTCAGAGGAATCTCGACCGCAGTCATT
  ACAACAGCCAGCCACATCCACTACAGAAACTCCGGCTTCTCCAGCTCACACAACTCCACAGACCCAAAGT
  ACAAGTGGTCGTCGGAGAAGAGCAGCTAACGAAGATCCTGATGAAAAAAGGAGAAAGTTTTTAGAGCGAA
  ATAGAGCAGCAGCTTCAAGATGCCGACAAAAAAGGAAAGTCTGGGTTCAGTCTTTAGAGAAGAAAGCTGA
  AGACTTGAGTTCATTAAATGGTCAGCTGCAGAGTGAAGTCACCCTGCTGAGAAATGAAGTGGCACAGCTG
  AAACAGCTTCTTCTGGCTCATAAAGATTGCCCTGTAACCGCCATGCAGAAGAAATCTGGCTATCATACTG
  CTGATAAAGATGATAGTTCAGAAGACATTTCAGTGCCGAGTAGTCCACATACAGAAGCTATACAGCATAG
  TTCGGTCAGCACATCCAATGGAGTCAGTTCAACCTCCAAGGCAGAAGCTGTAGCCACTTCAGTCCTCACC
  CAGATGGCGGACCAGAGTACAGAGCCTGCTCTTTCACAGATCGTTATGGCTCCTTCCTCCCAGTCACAGC
  CCTCAGGAAGTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256092
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256092.1, NP_001243021.1
• RefSeq Size: 4096 bp
• RefSeq ORF: 1344 bp
• Locus ID: 1386
• Cytogenetics: 2q31.1
• Protein Families: Druggable Genome, Transcription Factors
• Protein Pathways: MAPK signaling pathway
• Gene Summary: 'This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]'
  Transcript Variant: This variant (4) lacks an internal exon compared to variant 1. This results in translation initiation from another start site, and a shorter isoform (3) with a distinct N-terminus compared to isoform 1.