ATF2 (NM_001256094) Human Untagged Clone

CAT#: SC330364

ATF2 (untagged) - Homo sapiens activating transcription factor 2 (ATF2), transcript variant 6


  "NM_001256094" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "ATF2"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ATF2
Synonyms CRE-BP1; CREB-2; CREB2; HB16; TREB7
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256094, the custom clone sequence may differ by one or more nucleotides


ATGAAATTCAAGTTACATGTGAATTCTGCCAGGCAATACAAGGACCTGTGGAATATGAGTGATGACAAAC
CCTTTCTATGTACTGCGCCTGGATGTGGCCAGCGTTTTACCAACGAGGATCATTTGGCTGTCCATAAACA
TAAACATGAGATGACACTGAAATTTGGTCCAGCACGTAATGACAGTGTCATTGTGGCTGATCAGACCCCA
ACACCAACAAGATTCTTGAAAAACTGTGAAGAAGTGGGTTTGTTTAATGAGTTGGCGAGTCCATTTGAGA
ATGAATTCAAGAAAGCTTCAGAAGATGACATTAAAAAAATGCCTCTAGATTTATCCCCTCTTGCAACACC
TATCATAAGAAGCAAAATTGAGGAGCCTTCTGTTGTAGAAACAACTCACCAGGATAGTCCTTTACCTCAC
CCAGAGTCTACTACCAGTGATGAGAAGGAAGTACCATTGGCACAAACTGCACAGCCCACATCAGCTATTG
TTCGTCCAGCATCATTACAGGTTCCCAATGTGCTGCTTACAAGTTCTGACTCAAGTGTAATTATTCAGCA
GGCAGTACCTTCACCAACCTCAAGTACTGTAATCACCCAGGCACCATCCTCTAACAGGCCAATTGTGTAA


Restriction Sites SgfI-MluI     
ACCN NM_001256094
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256094.1, NP_001243023.1
RefSeq Size 1372 bp
RefSeq ORF 630 bp
Locus ID 1386
Cytogenetics 2q31.1
Protein Families Druggable Genome, Transcription Factors
Protein Pathways MAPK signaling pathway
Gene Summary 'This gene encodes a transcription factor that is a member of the leucine zipper family of DNA binding proteins. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions This protein binds to the cAMP-responsive element (CRE), an octameric palindrome. It forms a homodimer or a heterodimer with c-Jun and stimulates CRE-dependent transcription. This protein is also a histone acetyltransferase (HAT) that specifically acetylates histones H2B and H4 in vitro; thus it may represent a class of sequence-specific factors that activate transcription by direct effects on chromatin components. The encoded protein may also be involved in cell's DNA damage response independent of its role in transcriptional regulation. Several alternatively spliced transcript variants have been found for this gene [provided by RefSeq, Jan 2014]'
Transcript Variant: This variant (6) lacks several exons from the 3' end, and has a different 3' UTR compared to variant 1. This results in an isoform (5) with a shorter C-terminus compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.