CTHRC1 (NM_001256099) Human Untagged Clone

CAT#: SC330365

CTHRC1 (untagged) - Homo sapiens collagen triple helix repeat containing 1 (CTHRC1), transcript variant 2


  "NM_001256099" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CTHRC1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CTHRC1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256099, the custom clone sequence may differ by one or more nucleotides


ATGTGGCCGCCAGGTAGGAGCATCACAGTCAAGCTACGGGAGAAAACAGTTTCCAGGAAACTGGAAATGA
ACGGCCCGAGTGCTTTCCAGGGGCTCATCTGTGGGAAGTATAATGGAATGTGCTTACAAGGGCCAGCAGG
AGTGCCTGGTCGAGACGGGAGCCCTGGGGCCAATGGCATTCCGGGTACACCTGGGATCCCAGGTCGGGAT
GGATTCAAAGGAGAAAAGGGGGAATGTCTGAGGGAAAGCTTTGAGGAGTCCTGGACACCCAACTACAAGC
AGTGTTCATGGAGTTCATTGAATTATGGCATAGATCTTGGGAAAATTGCGGAGTGTACATTTACAAAGAT
GCGTTCAAATAGTGCTCTAAGAGTTTTGTTCAGTGGCTCACTTCGGCTAAAATGCAGAAATGCATGCTGT
CAGCGTTGGTATTTCACATTCAATGGAGCTGAATGTTCAGGACCTCTTCCCATTGAAGCTATAATTTATT
TGGACCAAGGAAGCCCTGAAATGAATTCAACAATTAATATTCATCGCACTTCTTCTGTGGAAGGACTTTG
TGAAGGAATTGGTGCTGGATTAGTGGATGTTGCTATCTGGGTTGGTACTTGTTCAGATTACCCAAAAGGA
GATGCTTCTACTGGATGGAATTCAGTTTCTCGCATCATTATTGAAGAACTACCAAAATAA


Restriction Sites SgfI-MluI     
ACCN NM_001256099
ORF Size 690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256099.1, NP_001243028.1
RefSeq Size 1214
RefSeq ORF 690
Locus ID 115908
Protein Families Secreted Protein
Gene Summary This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (2) differs in the 5' UTR, contains an alternate in-frame 5' terminal exon, and uses an alternate start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.