CTHRC1 (NM_001256099) Human Untagged Clone
CAT#: SC330365
CTHRC1 (untagged) - Homo sapiens collagen triple helix repeat containing 1 (CTHRC1), transcript variant 2
"NM_001256099" in other vectors (2)
Product Images
Other products for "CTHRC1"
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | CTHRC1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256099, the custom clone sequence may differ by one or more nucleotides
ATGTGGCCGCCAGGTAGGAGCATCACAGTCAAGCTACGGGAGAAAACAGTTTCCAGGAAACTGGAAATGA ACGGCCCGAGTGCTTTCCAGGGGCTCATCTGTGGGAAGTATAATGGAATGTGCTTACAAGGGCCAGCAGG AGTGCCTGGTCGAGACGGGAGCCCTGGGGCCAATGGCATTCCGGGTACACCTGGGATCCCAGGTCGGGAT GGATTCAAAGGAGAAAAGGGGGAATGTCTGAGGGAAAGCTTTGAGGAGTCCTGGACACCCAACTACAAGC AGTGTTCATGGAGTTCATTGAATTATGGCATAGATCTTGGGAAAATTGCGGAGTGTACATTTACAAAGAT GCGTTCAAATAGTGCTCTAAGAGTTTTGTTCAGTGGCTCACTTCGGCTAAAATGCAGAAATGCATGCTGT CAGCGTTGGTATTTCACATTCAATGGAGCTGAATGTTCAGGACCTCTTCCCATTGAAGCTATAATTTATT TGGACCAAGGAAGCCCTGAAATGAATTCAACAATTAATATTCATCGCACTTCTTCTGTGGAAGGACTTTG TGAAGGAATTGGTGCTGGATTAGTGGATGTTGCTATCTGGGTTGGTACTTGTTCAGATTACCCAAAAGGA GATGCTTCTACTGGATGGAATTCAGTTTCTCGCATCATTATTGAAGAACTACCAAAATAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256099 |
ORF Size | 690 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Reference Data | |
RefSeq | NM_001256099.1, NP_001243028.1 |
RefSeq Size | 1214 |
RefSeq ORF | 690 |
Locus ID | 115908 |
Protein Families | Secreted Protein |
Gene Summary | This locus encodes a protein that may play a role in the cellular response to arterial injury through involvement in vascular remodeling. Mutations at this locus have been associated with Barrett esophagus and esophageal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012] Transcript Variant: This variant (2) differs in the 5' UTR, contains an alternate in-frame 5' terminal exon, and uses an alternate start codon, compared to variant 1. Isoform 2 has a shorter N-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
{0} Product Review(s)
0 Product Review(s)
Submit review
Be the first one to submit a review
Product Citations
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen
complexities in the preparation of your product. International customers may expect an additional 1-2 weeks
in shipping.