ARD1A (NAA10) (NM_001256120) Human Untagged Clone

CAT#: SC330367

NAA10 (untagged) - Homo sapiens N(alpha)-acetyltransferase 10, NatA catalytic subunit (NAA10), transcript variant 3


  "NM_001256120" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "NAA10"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol NAA10
Synonyms ARD1; ARD1A; ARD1P; DXS707; hARD1; MCOPS1; NATD; OGDNS; TE2
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256120, the custom clone sequence may differ by one or more nucleotides


ATGAACATCCGCAATGCGAGGCCAGAGGACCTAATGAACATGCAGCACTGCAACCTCCTCTGCCTGCCCG
AGAACTACCAGATGAAATACTACTTCTACCATGGCCTTTCCTGGCCCCAGCTCTCTTACATTGCTGAGGA
CGAGAATGGGAAGATTGTGGGGGAAGAGGACCCAGATGATGTGCCCCATGGACATATCACCTCATTGGCT
GTGAAGCGTTCCCACCGGCGCCTCGGTCTGGCTCAGAAACTGATGGACCAGGCCTCTCGAGCCATGATAG
AGAACTTCAATGCCAAATATGTCTCCCTGCATGTCAGGAAGAGTAACCGGGCCGCCCTGCACCTCTATTC
CAACACCCTCAACTTTCAGATCAGTGAAGTGGAGCCCAAATACTATGCAGATGGGGAGGACGCCTATGCC
ATGAAGCGGGACCTCACTCAGATGGCCGACGAGCTGAGGCGGCACCTGGAGCTGAAAGAGAAGGGCAGGC
ACGTGGTGCTGGGTGCCATCGAGAACAAGGTGGAGAGCAAAGGCAATTCACCTCCGAGCTCAGGAGAGGC
CTGTCGCGAGGAGAAGGGCCTGGCTGCCGAGGATAGTGGTGGGGACAGCAAGGACCTCAGCGAGGTCAGC
GAGACCACAGAGAGCACAGATGTCAAGGACAGCTCAGAGGCCTCCGACTCAGCCTCCTAG


Restriction Sites SgfI-MluI     
ACCN NM_001256120
ORF Size 690 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256120.1, NP_001243049.1
RefSeq Size 1118
RefSeq ORF 690
Locus ID 8260
Protein Families Druggable Genome
Protein Pathways Glycerophospholipid metabolism, Limonene and pinene degradation, Phenylalanine metabolism, Tyrosine metabolism
Gene Summary N-alpha-acetylation is among the most common post-translational protein modifications in eukaryotic cells. This process involves the transfer of an acetyl group from acetyl-coenzyme A to the alpha-amino group on a nascent polypeptide and is essential for normal cell function. This gene encodes an N-terminal acetyltransferase that functions as the catalytic subunit of the major amino-terminal acetyltransferase A complex. Mutations in this gene are the cause of Ogden syndrome. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (3) uses an alternate in-frame splice site in the central coding region, compared to variant 1. This results in a shorter protein (isoform 3), compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.