Actin Regulatory Protein CAPG (CAPG) (NM_001256140) Human Untagged Clone

CAT#: SC330374

CAPG (untagged) - Homo sapiens capping protein (actin filament), gelsolin-like (CAPG), transcript variant 3


  "NM_001256140" in other vectors (2)

Reconstitution Protocol

USD 340.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CAPG"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CAPG
Synonyms AFCP; HEL-S-66; MCP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256140, the custom clone sequence may differ by one or more nucleotides


ATGTACACAGCCATTCCCCAGAGTGGCTCTCCATTCCCAGGCTCAGTGCAGGATCCAGGCCTGCATGTGT
GGCGGGTGGAGAAGCTGAAGCCGGTGCCTGTGGCGCAAGAGAACCAGGGCGTCTTCTTCTCGGGGGACTC
CTACCTAGTGCTGCACAATGGCCCAGAAGAGGTTTCCCATCTGCACCTGTGGATAGGCCAGCAGTCATCC
CGGGATGAGCAGGGGGCCTGTGCCGTGCTGGCTGTGCACCTCAACACGCTGCTGGGAGAGCGGCCTGTGC
AGCACCGCGAGGTGCAGGGCAATGAGTCTGACCTCTTCATGAGCTACTTCCCACGGGGCCTCAAGTACCA
GGAAGGTGGTGTGGAGTCAGCATTTCACAAGACCTCCACAGGAGCCCCAGCTGCCATCAAGAAACTCTAC
CAGGTGAAGGGGAAGAAGAACATCCGTGCCACCGAGCGGGCACTGAACTGGGACAGCTTCAACACTGGGG
ACTGCTTCATCCTGGACCTGGGCCAGAACATCTTCGCCTGGTGTGGTGGAAAGTCCAACATCCTGGAACG
CAACAAGGCGAGGGACCTGGCCCTGGCCATCCGGGACAGTGAGCGACAGGGCAAGGCCCAGGTCCTGGGC
CCCAAGCCTGCTCTGAAGGAGGGCAACCCTGAGGAAGACCTCACAGCTGACAAGGCAAATGCCCAGGCCG
CAGCTCTGTATAAGGTCTCTGATGCCACTGGACAGATGAACCTGACCAAGGTGGCTGACTCCAGCCCATT
TGCCCTTGAACTGCTGATATCTGATGACTGCTTTGTGCTGGACAACGGGCTCTGTGGCAAGATCTATATC
TGGAAGGGGCGAAAAGCGAATGAGAAGGAGCGGCAGGCAGCCCTGCAGGTGGCCGAGGGCTTCATCTCGC
GCATGCAGTACGCCCCGAACACTCAGGTGGAGATTCTGCCTCAGGGCCATGAGAGTCCCATCTTCAAGCA
ATTTTTCAAGGACTGGAAATGA


Restriction Sites SgfI-MluI     
ACCN NM_001256140
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256140.1, NP_001243069.1
RefSeq Size 1559 bp
RefSeq ORF 1002 bp
Locus ID 822
Cytogenetics 2p11.2
Gene Summary 'This gene encodes a member of the gelsolin/villin family of actin-regulatory proteins. The encoded protein reversibly blocks the barbed ends of F-actin filaments in a Ca2+ and phosphoinositide-regulated manner, but does not sever preformed actin filaments. By capping the barbed ends of actin filaments, the encoded protein contributes to the control of actin-based motility in non-muscle cells. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Jan 2012]'
Transcript Variant: This variant (3) uses an alternate in-frame splice junction compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.