ALIX (PDCD6IP) (NM_001256192) Human Untagged Clone

CAT#: SC330382

PDCD6IP (untagged) - Homo sapiens programmed cell death 6 interacting protein (PDCD6IP), transcript variant 4

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PDCD6IP
• Synonyms: AIP1; ALIX; DRIP4; HP95
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256192, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGCGACATTCATCTCGGTGCAGCTGAAAAAGACCTCAGAGGTGGACCTGGCCAAGCCGCTGGTGAAGT
  TCATCCAGCAGACTTACCCAAGCGGCGGGGAAGAGCAGGCCCAGTACTGCCGCGCGGCGGAGGAGCTCAG
  CAAGCTGCGCCGCGCCGCAGTCGGTCGTCCGCTGGACAAGCACGAGGGCGCGCTCGAGACGCTCCTGAGA
  TATTATGATCAGATTTGTTCTATTGAACCCAAATTCCCATTTTCTGAAAATCAGATCTGCTTGACATTTA
  CCTGGAAGGATGCTTTCGATAAAGGTTCACTTTTTGGAGGCTCTGTAAAACTGGCTCTTGCAAGCTTAGG
  ATATGAAAAGAGCTGTGTGTTGTTCAATTGTGCAGCCTTAGCTAGCCAAATTGCAGCAGAACAGAACCTG
  GATAATGATGAAGGATTGAAAATCGCTGCTAAACATTACCAGTTTGCTAGTGGTGCCTTTTTACATATTA
  AAGAGACGGTTTTATCTGCCTTAAGTCGAGAGCCGACCGTGGACATATCTCCAGATACTGTTGGGACCCT
  CAGTCTTATTATGCTGGCACAGGCTCAAGAAGTATTTTTTTTAAAAGCCACAAGAGATAAAATGAAAGAT
  GCCATCATAGCTAAATTGGCTAATCAGGCTGCAGATTATTTTGGTGATGCTTTCAAACAGTGTCAATACA
  AAGATACTCTCCCCAAGGTCAGTTATTGTTTTTATAAACACTTGCTTACTTTGCATGTGAAATATTTAGA
  CTTTTTTGTGTATAAGAAGCAAGTTGAAACTTATAAAGAAATTTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256192
• ORF Size: 816 bp
• OTI Disclaimer: Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.
  
  The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info

Reference Data

• RefSeq: NM_001256192.1, NP_001243121.1
• RefSeq Size: 1569
• RefSeq ORF: 816
• Locus ID: 10015
• Protein Families: Druggable Genome
• Protein Pathways: Endocytosis
• Gene Summary: This gene encodes a protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intralumenal endosomal vesicle formation, and in enveloped virus budding. Studies using mouse cells have shown that overexpression of this protein can block apoptosis. In addition, the product of this gene binds to the product of the PDCD6 gene, a protein required for apoptosis, in a calcium-dependent manner. This gene product also binds to endophilins, proteins that regulate membrane shape during endocytosis. Overexpression of this gene product and endophilins results in cytoplasmic vacuolization, which may be partly responsible for the protection against cell death. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. Related pseudogenes have been identified on chromosome 15. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (4) lacks several 3' exons but contains an alternate 3' exon, and it thus differs in the 3' coding region and 3' UTR, compared to variant 2. The encoded isoform (3) has a distinct and significantly shorter C-terminus, compared to isoform 2.