Brk (PTK6) (NM_001256358) Human Untagged Clone

CAT#: SC330401

PTK6 (untagged) - Homo sapiens protein tyrosine kinase 6 (PTK6), transcript variant 2

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: PTK6
• Synonyms: BRK
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256358, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGTGTCCCGGGACCAGGCTCACCTGGGCCCCAAGTATGTGGGCCTCTGGGACTTCAAGTCCCGGACGG
  ACGAGGAGCTGAGCTTCCGCGCGGGGGACGTCTTCCACGTGGCCAGGAAGGAGGAGCAGTGGTGGTGGGC
  CACGCTGCTGGACGAGGCGGGTGGGGCCGTGGCCCAGGGCTATGTGCCCCACAACTACCTGGCCGAGAGG
  GAGACGGTGGAGTCGGAACCTGCGGGACACGCAGGCTGTGCGGCACTACAAGATCTGGCGGCGTGCCGGG
  GGCCGGCTGCACCTGAACGAGGCGGTGTCCTTCCTCAGCCTGCCCGAGCTTGTGAACTACCACAGGGCCC
  AGAGCCTGTCCCACGGCCTGCGGCTGGCCGCGCCCTGCCGGAAGCACGAGCCTGA
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256358
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
• Product Components: The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
• Reconstitution: 1. Centrifuge at 5,000xg for 5min.
  2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
  3. Close the tube and incubate for 10 minutes at room temperature.
  4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
  5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.

Reference Data

• RefSeq: NM_001256358.1, NP_001243287.1
• RefSeq Size: 2413 bp
• RefSeq ORF: 405 bp
• Locus ID: 5753
• Cytogenetics: 20q13.33
• Protein Families: Druggable Genome, Protein Kinase, Secreted Protein
• Gene Summary: 'The protein encoded by this gene is a cytoplasmic nonreceptor protein kinase which may function as an intracellular signal transducer in epithelial tissues. Overexpression of this gene in mammary epithelial cells leads to sensitization of the cells to epidermal growth factor and results in a partially transformed phenotype. Expression of this gene has been detected at low levels in some breast tumors but not in normal breast tissue. The encoded protein has been shown to undergo autophosphorylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2012]'
  Transcript Variant: This variant (2) lacks an exon in the 5' coding region which results in a frameshift and early stop codon, compared to variant 1. The resulting protein (isoform 2) has a shorter and distinct C-terminus, compared to isoform 1. This variant is also known as lambdaM5 and Alt-PTK6. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.