CCR9 (NM_001256369) Human Untagged Clone

CAT#: SC330402

CCR9 (untagged) - Homo sapiens chemokine (C-C motif) receptor 9 (CCR9), transcript variant C


  "NM_001256369" in other vectors (2)

Reconstitution Protocol

USD 360.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "CCR9"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol CCR9
Synonyms CC-CKR-9; CDw199; GPR-9-6; GPR28
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256369, the custom clone sequence may differ by one or more nucleotides


ATGGCTGATGACTATGGCTCTGAATCCACATCTTCCATGGAAGACTACGTTAACTTCAACTTCACTGACT
TCTACTGTGAGAAAAACAATGTCAGGCAGTTTGCGAGCCATTTCCTCCCACCCTTGTACTGGCTCGTGTT
CATCGTGGGTGCCTTGGGCAACAGTCTTGTTATCCTTGTCTACTGGTACTGCACAAGAGTGAAGACCATG
ACCGACATGTTCCTTTTGAATTTGGCAATTGCTGACCTCCTCTTTCTTGTCACTCTTCCCTTCTGGGCCA
TTGCTGCTGCTGACCAGTGGAAGTTCCAGACCTTCATGTGCAAGGTGGTCAACAGCATGTACAAGATGAA
CTTCTACAGCTGTGTGTTGCTGATCATGTGCATCAGCGTGGACAGGTACATTGCCATTGCCCAGGCCATG
AGAGCACATACTTGGAGGGAGAAAAGGCTTTTGTACAGCAAAATGGTTTGCTTTACCATCTGGGTATTGG
CAGCTGCTCTCTGCATCCCAGAAATCTTATACAGCCAAATCAAGGAGGAATCCGGCATTGCTATCTGCAC
CATGGTTTACCCTAGCGATGAGAGCACCAAACTGAAGTCAGCTGTCTTGACCCTGAAGGTCATTCTGGGG
TTCTTCCTTCCCTTCGTGGTCATGGCTTGCTGCTATACCATCATCATTCACACCCTGATACAAGCCAAGA
AGTCTTCCAAGCACAAAGCCCTAAAAGTGACCATCACTGTCCTGACCGTCTTTGTCTTGTCTCAGTTTCC
CTACAACTGCATTTTGTTGGTGCAGACCATTGACGCCTATGCCATGTTCATCTCCAACTGTGCCGTTTCC
ACCAACATTGACATCTGCTTCCAGGTCACCCAGACCATCGCCTTCTTCCACAGTTGCCTGAACCCTGTTC
TCTATGTTTTTGTGGGTGAGAGATTCCGCCGGGATCTCGTGAAAACCCTGAAGAACTTGGGTTGCATCAG
CCAGGCCCAGTGGGTTTCATTTACAAGGAGAGAGGGAAGCTTGAAGCTGTCGTCTATGTTGCTGGAGACA
ACCTCAGGAGCACTCTCCCTCTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256369
ORF Size 1074 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256369.1, NP_001243298.1
RefSeq Size 2653
RefSeq ORF 1074
Locus ID 10803
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Chemokine signaling pathway, Cytokine-cytokine receptor interaction
Gene Summary The protein encoded by this gene is a member of the beta chemokine receptor family. It is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are key regulators of the thymocytes migration and maturation in normal and inflammation conditions. The specific ligand of this receptor is CCL25. It has been found that this gene is differentially expressed by T lymphocytes of small intestine and colon, suggested a role in the thymocytes recruitment and development that may permit functional specialization of immune responses in different segment of the gastrointestinal tract. This gene is mapped to the chemokine receptor gene cluster region. Two alternatively spliced transcript variants have been described. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (C) includes an alternate internal exon and initiates translation at a downstream, in-frame start codon, compared to variant 1. Variants B and C encode the same isoform (B), which has a shorter N-terminus compared to isoform A.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.