ELOVL1 (NM_001256401) Human Untagged Clone

CAT#: SC330414

ELOVL1 (untagged) - Homo sapiens ELOVL fatty acid elongase 1 (ELOVL1), transcript variant 3


  "NM_001256401" in other vectors (2)

Reconstitution Protocol

USD 310.00

In Stock*

Size
    • 10 ug

Product Images

Other products for "ELOVL1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol ELOVL1
Synonyms CGI-88; Ssc1
Vector PCMV6-Neo
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001256401, the custom clone sequence may differ by one or more nucleotides


ATGGAGGCTGTTGTGAACTTGTACCAAGAGGTGATGAAGCACGCAGATCCCCGGATCCAGGGCTACCCTC
TGATGGGGTCCCCCTTGCTAATGACCTCCATTCTCCTGACCTACGTGTACTTCGTTCTCTCACTTGGGCC
TCGCATCATGGCTAATCGGAAGCCCTTCCAGCTCCGTGGCTTCATGATTGTCTACAACTTCTCACTGGTG
GCACTCTCCCTCTACATTGTCTATGAGATGGTTCGGGTGGCCTGGCTCTTCCTCTTCTCCAAGTTCATTG
AGCTGATGGACACAGTGATCTTTATTCTCCGAAAGAAAGACGGGCAGGTGACCTTCCTACATGTCTTCCA
TCACTCTGTGCTTCCCTGGAGCTGGTGGTGGGGGGTAAAGATTGCCCCGGGAGGAATGGGCTCTTTCCAT
GCCATGATAAACTCTTCCGTGCATGTCATAATGTACCTGTACTACGGATTATCTGCCTTTGGCCCTGTGG
CACAACCCTACCTTTGGTGGAAAAAGCACATGACAGCCATTCAGCTGATCCAGTTTGTCCTGGTCTCACT
GCACATCTCCCAGTACTACTTTATGTCCAGCTGTAACTACCAGTACCCAGTCATTATTCACCTCATCTGG
ATGTATGGCACCATCTTCTTCATGCTGTTCTCCAACTTCTGGTATCACTCTTATACCAAGGGCAAGCGGC
TGCCCCGTGCACTTCAGCAAAATGGAGCTCCAGGTATTGCCAAGGTCAAGGCCAACTGA


Restriction Sites SgfI-MluI     
ACCN NM_001256401
ORF Size 759 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Reference Data
RefSeq NM_001256401.1, NP_001243330.1
RefSeq Size 1457
RefSeq ORF 759
Locus ID 64834
Protein Families Transmembrane

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.