RAB18 (NM_001256411) Human Untagged Clone

CAT#: SC330420

RAB18 (untagged) - Homo sapiens RAB18, member RAS oncogene family (RAB18), transcript variant 3

Specifications

Product Data

• Type: Human Untagged Clone
• Tag: Tag Free
• Symbol: RAB18
• Synonyms: RAB18LI1; WARBM3
• Vector: pCMV6 series
• Sequence Data:
  Fully Sequenced ORF

  >NCBI ORF sequence for NM_001256411, the custom clone sequence may differ by one or more nucleotides
  
  
  ATGGACGAGGACGTGCTAACCACCCTGAAGATCCTCATCATCGGCGAGAGTGGGGTGGGCAAGTCCAGCC
  TGCTCTTGAGGTTCACAGATGATACGTTTGATCCAGAACTTGCAGCAACAATAGGTGTTGACTTTAAGGT
  GAAAACAATTTCAGTGGATGGAAATAAGGCTAAACTTGCAATATGGGATACTGCTGGTCAAGAGAGGTTT
  AGAACATTAACTCCCAGCTATTATAGAGGTGCACAGGGTGTTATATTAGTTTATGATGTCACAAGAAGAG
  ATACATTTGTTAAACTGGATAATTGGTTAAATGAATTGGAAACATACTGTACAAGAAATGACATAGTAAA
  CATGCTAGTTGGAAATAAAATCGATAAGAGGCAAGTGCAAAAACCTGTGATGGTGTACAATGTGCCTTTG
  AAGAACTTGTTGAAAAGATCATTCAGACCCCTGGACTGTGGGAAAGTGAGAACCAGAATAAAGGAGTCAA
  ACTGTCACACAGGGAAGAAGGCCAAGGAGGAGGAGCCTGTGGTGGTTATTGCTCTGTGTTATAAACTCTG
  GGAAATTCCATCTCTTGCATATTTGATCAGATAG
  
  
• Restriction Sites: SgfI-MluI
• ACCN: NM_001256411
• ORF Size: 594 bp
• OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

Reference Data

• RefSeq: NM_001256411.1, NP_001243340.1
• RefSeq Size: 4936
• RefSeq ORF: 594
• Locus ID: 22931
• Protein Families: Druggable Genome
• Gene Summary: The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
  Transcript Variant: This variant (3) lacks the penultimate coding exon compared to variant 1. This results in a frame-shift, and a shorter isoform (3) with a distinct C-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.