RAB18 (NM_001256412) Human Untagged Clone

CAT#: SC330421

RAB18 (untagged) - Homo sapiens RAB18, member RAS oncogene family (RAB18), transcript variant 5


  "NM_001256412" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "RAB18"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol RAB18
Synonyms RAB18LI1; WARBM3
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256412, the custom clone sequence may differ by one or more nucleotides


ATGGACGAGGACGTGCTAACCACCCTGAAGATCCTCATCATCGGCGAGAGTGGGGTGGGCAAGTCCAGCC
TGCTCTTGAGGTTCACAGATGATACGTTTGATCCAGAACTTGCAGCAACAATAGGTGTTGACTTTAAGGT
GAAAACAATTTCAGTGGATGGAAATAAGGCTAAACTTGCAATATGGGAAAATCGTGAAGTCGATAGAAAT
GAAGGCCTGAAATTTGCACGAAAGCATTCCATGTTATTTATAGAGGCAAGTGCAAAAACCTGTGATGGTG
TACAATGTGCCTTTGAAGAACTTGTTGAAAAGATCATTCAGACCCCTGGACTGTGGGAAAGTGAGAACCA
GAATAAAGGAGTCAAACTGTCACACAGGGAAGAAGGCCAAGGAGGAGGAGCCTGTGGTGGTTATTGCTCT
GTGTTATAA


Restriction Sites SgfI-MluI     
ACCN NM_001256412
ORF Size 429 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Reference Data
RefSeq NM_001256412.1, NP_001243341.1
RefSeq Size 4811
RefSeq ORF 429
Locus ID 22931
Protein Families Druggable Genome
Gene Summary The protein encoded by this gene is a member of a family of Ras-related small GTPases that regulate membrane trafficking in organelles and transport vesicles. Knockdown studies is zebrafish suggest that this protein may have a role in eye and brain development. Mutations in this gene are associated with Warburg micro syndrome type 3. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2012]
Transcript Variant: This variant (5) lacks 2 consecutive coding exons compared to variant 1. However, it maintains the reading frame, and encodes a shorter isoform (5) missing an internal protein segment compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.