SSBP1 (NM_001256512) Human Untagged Clone
CAT#: SC330443
SSBP1 (untagged) - Homo sapiens single-stranded DNA binding protein 1, mitochondrial (SSBP1), transcript variant 3
"NM_001256512" in other vectors (2)
Product Images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Symbol | SSBP1 |
Synonyms | Mt-SSB; mtSSB; SOSS-B1; SSBP |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001256512, the custom clone sequence may differ by one or more nucleotides
ATGTTTCGAAGACCTGTATTACAGGTACTTCGTCAGTTTGTAAGACATGAGTCCGAAACAACTACCAGTT TGGTTCTTGAAAGATCCCTGAATCGTGTGCACTTACTTGGGCGAGTGGGTCAGGACCCTGTCTTGAGACA GGTGGAAGGAAAAAATCCAGTCACAATATTTTCTCTAGCAACTAATGAGATGTGGCGATCAGGGGATAGT GAAGTTTACCAACTGGGTGATGTCAGTCAAAAGACAACATGGCACAGAATATCAGTATTCCGGCCAGGCC TCAGAGACGTGGCATATCAATATGTGAAAAAGGGGTCTCGAATTTATTTGGAAGGGAAAATAGACTATGG TGAATACATGGATAAAAATAATGTGAGGCGACAAGCAACAACAATCATAGCTGATAATATTATATTTCTG AGTGACCAGACGAAAGAGAAGGAGTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001256512 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones. |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001256512.1, NP_001243441.1 |
RefSeq Size | 879 bp |
RefSeq ORF | 447 bp |
Locus ID | 6742 |
Cytogenetics | 7q34 |
Protein Families | Druggable Genome |
Protein Pathways | DNA replication, Homologous recombination, Mismatch repair |
Gene Summary | 'SSBP1 is a housekeeping gene involved in mitochondrial biogenesis (Tiranti et al., 1995 [PubMed 7789991]). It is also a subunit of a single-stranded DNA (ssDNA)-binding complex involved in the maintenance of genome stability (Huang et al., 2009) [PubMed 19683501].[supplied by OMIM, Feb 2010]' Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 through 5 encode the same protein. |
Documents
Product Manuals |
FAQs |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC231847 | SSBP1 (Myc-DDK tagged) - Homo sapiens single-stranded DNA binding protein 1, mitochondrial (SSBP1), transcript variant 3 |
USD 420.00 |
|
RG231847 | SSBP1 (GFP-tagged) - Homo sapiens single-stranded DNA binding protein 1, mitochondrial (SSBP1), transcript variant 3 |
USD 460.00 |
{0} Product Review(s)
Be the first one to submit a review