SSBP1 (NM_001256512) Human Untagged Clone

CAT#: SC330443

SSBP1 (untagged) - Homo sapiens single-stranded DNA binding protein 1, mitochondrial (SSBP1), transcript variant 3


  "NM_001256512" in other vectors (2)

Reconstitution Protocol

USD 310.00

3 Weeks*

Size
    • 10 ug

Product Images

Other products for "SSBP1"

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Symbol SSBP1
Synonyms Mt-SSB; mtSSB; SOSS-B1; SSBP
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001256512, the custom clone sequence may differ by one or more nucleotides


ATGTTTCGAAGACCTGTATTACAGGTACTTCGTCAGTTTGTAAGACATGAGTCCGAAACAACTACCAGTT
TGGTTCTTGAAAGATCCCTGAATCGTGTGCACTTACTTGGGCGAGTGGGTCAGGACCCTGTCTTGAGACA
GGTGGAAGGAAAAAATCCAGTCACAATATTTTCTCTAGCAACTAATGAGATGTGGCGATCAGGGGATAGT
GAAGTTTACCAACTGGGTGATGTCAGTCAAAAGACAACATGGCACAGAATATCAGTATTCCGGCCAGGCC
TCAGAGACGTGGCATATCAATATGTGAAAAAGGGGTCTCGAATTTATTTGGAAGGGAAAATAGACTATGG
TGAATACATGGATAAAAATAATGTGAGGCGACAAGCAACAACAATCATAGCTGATAATATTATATTTCTG
AGTGACCAGACGAAAGAGAAGGAGTAG


Restriction Sites SgfI-MluI     
ACCN NM_001256512
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The cDNA clone is shipped in a 2-D bar-coded Matrix tube as dried plasmid DNA. The package also includes 100 pmols of both the corresponding 5' and 3' vector primers in separate vials. Every lot of primer is tested to provide clean sequencing of OriGene TrueClones.
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001256512.1, NP_001243441.1
RefSeq Size 879 bp
RefSeq ORF 447 bp
Locus ID 6742
Cytogenetics 7q34
Protein Families Druggable Genome
Protein Pathways DNA replication, Homologous recombination, Mismatch repair
Gene Summary 'SSBP1 is a housekeeping gene involved in mitochondrial biogenesis (Tiranti et al., 1995 [PubMed 7789991]). It is also a subunit of a single-stranded DNA (ssDNA)-binding complex involved in the maintenance of genome stability (Huang et al., 2009) [PubMed 19683501].[supplied by OMIM, Feb 2010]'
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 through 5 encode the same protein.

Other Versions

{0} Product Review(s)

0 Product Review(s) Submit review

Be the first one to submit a review

Product Citations

*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.